ptpn22

Ensembl ID:
ENSDARG00000075062
ZFIN ID:
ZDB-GENE-060503-458
Description:
tyrosine-protein phosphatase non-receptor type 22 [Source:RefSeq peptide;Acc:NP_001092890]
Human Orthologue:
PTPN22
Human Description:
protein tyrosine phosphatase, non-receptor type 22 (lymphoid) [Source:HGNC Symbol;Acc:9652]
Mouse Orthologue:
Ptpn22
Mouse Description:
protein tyrosine phosphatase, non-receptor type 22 (lymphoid) Gene [Source:MGI Symbol;Acc:MGI:107170

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa12441 Essential Splice Site Available for shipment Available now
sa37721 Nonsense Mutation detected in F1 DNA During 2017
sa9634 Essential Splice Site Available for shipment Available now
sa11960 Essential Splice Site Available for shipment Available now
sa24347 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa12441
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087343 Essential Splice Site 97 905 None 30
ENSDART00000103869 Essential Splice Site 97 130 None 4
ENSDART00000129280 Essential Splice Site 97 888 None 29
Genomic Location (Zv9):
Chromosome 23 (position 26441918)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 26228038
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCATTCGAGAGGATTTGGGAACCACTTGTCMTGTATTCTGTATTTATTTC[A/T]GGGTGTTTCAGGCTCTAAAGCATATATTGCCACCCAAGGGCCACTGTCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37721
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087343 Nonsense 102 905 4 30
ENSDART00000103869 Nonsense 102 130 4 4
ENSDART00000129280 Nonsense 102 888 4 29
Genomic Location (Zv9):
Chromosome 23 (position 26441935)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 26228055
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGAACCACTTGTCATGTATTCTGTATTTATTTCAGGGTGTTTCAGGCTCT[A/T]AAGCATATATTGCCACCCAAGGGCCACTGTCAAACACTGTGCTTGACTTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9634
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087343 Essential Splice Site 308 905 11 30
ENSDART00000103869   None 130 None 4
ENSDART00000129280 Essential Splice Site 308 888 11 29
Genomic Location (Zv9):
Chromosome 23 (position 26449018)
KASP Assay ID:
2261-7832.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGTTGCTGTTYGAAAGATATCTGGCAGCACTTGAAGCACCAAGTAACAAG[G/A]TYRGATGAGAACAAACTAAATACAACAAWGATGCCAAATATTACATTTCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11960
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087343 Essential Splice Site 844 905 27 30
ENSDART00000103869   None 130 None 4
ENSDART00000129280 Essential Splice Site 827 888 26 29
Genomic Location (Zv9):
Chromosome 23 (position 26459206)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 26244936
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAAACAAAGGGRCAGAGAAAACTTCACTGGTCAGCAAAGCAAGGAGCAAG[G/A]TTCAACTTCTTAAGTCTCTWAATTTTGGAACATRTTGTAAAGKGTTTRAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24347
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087343 Nonsense 854 905 28 30
ENSDART00000103869   None 130 None 4
ENSDART00000129280 Nonsense 837 888 27 29
Genomic Location (Zv9):
Chromosome 23 (position 26460595)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 26246335
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TATGTGTTTCTTTTCTATTGCAGAGTTTCAAGCTTTTAAAAGGAAAACAG[A/T]AGCGTATGTATAATAAACTTTTCTACATTTCATGCTGCTTAAATCTGTTT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link