LOC555630

Ensembl ID:
ENSDARG00000075057
Human Orthologue:
KIAA0391
Human Description:
KIAA0391 [Source:HGNC Symbol;Acc:19958]
Mouse Orthologue:
1110008L16Rik
Mouse Description:
RIKEN cDNA 1110008L16 gene Gene [Source:MGI Symbol;Acc:MGI:1913382]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa36352 Nonsense Mutation detected in F1 DNA During 2016
sa12412 Nonsense Available for shipment Available now
sa32133 Nonsense Mutation detected in F1 DNA During 2016
sa39152 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa36352
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111098 Nonsense 2 502 1 8
Genomic Location (Zv9):
Chromosome 17 (position 12870295)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 12852817
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGTGGAAAGTTTCCATTACATCTAAATTAACGTTAGTTAAAATACATTA[T/A]TGTAAGGATAATGGGATTTGTAGCTATGTCAAAATCAAGGACCTGCATGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12412
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111098 Nonsense 19 502 2 8
Genomic Location (Zv9):
Chromosome 17 (position 12870005)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 12852527
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGTATTCAGTGCCGGRGCRGCCAGAAAAAGAGCCRAATTTTTGAAACAT[A/T]AGTCAGGSTTRGATACAGAARATGATGATACACCTGTGAGAGYCAGAGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32133
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111098 Nonsense 228 502 2 8
Genomic Location (Zv9):
Chromosome 17 (position 12869376)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 12851898
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGGATCACTCAGCGAGGACATGAGGATAAACTATTTGATGTTCTTTCATA[T/A]ATGAGAGATAATCAGATCTACCCAGAGAAACCACTGATGGAAACCATCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39152
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111098 Nonsense 441 502 7 8
Genomic Location (Zv9):
Chromosome 17 (position 12836364)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 12818886
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CATAAAGCCTGCCTGCCGGACAGTGCCACCAGATGCCTCTTCTTCAAGTG[G/A]CAGCGTGGGCATCAGCTGGTCATCAGCCATTACACACCAGGAAAAAGAGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link