RASGRF2 (1 of 2)

Ensembl ID:
ENSDARG00000075054
Description:
Ras protein-specific guanine nucleotide-releasing factor 2 [Source:HGNC Symbol;Acc:9876]
Human Orthologue:
RASGRF2
Human Description:
Ras protein-specific guanine nucleotide-releasing factor 2 [Source:HGNC Symbol;Acc:9876]
Mouse Orthologue:
Rasgrf2
Mouse Description:
RAS protein-specific guanine nucleotide-releasing factor 2 Gene [Source:MGI Symbol;Acc:MGI:109137]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa30930 Essential Splice Site Mutation detected in F1 DNA During 2017
sa41571 Essential Splice Site Mutation detected in F1 DNA During 2017
sa41572 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa30930
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081794 Essential Splice Site 178 1028 3 21
ENSDART00000081794 Essential Splice Site 178 1028 3 21
Genomic Location (Zv9):
Chromosome 10 (position 3095983)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 3122764
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GACTCAACTGGAGGACCAGGATACAGAGATCGAGAGGCTGAAGGCCGAGG[T/G]TCGTTTATCGTCTTCAGCTCAATCCAAGGTTGTCAGGTGCCAGAAAAAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41571
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081794 Essential Splice Site 178 1028 3 21
ENSDART00000081794 Essential Splice Site 178 1028 3 21
Genomic Location (Zv9):
Chromosome 10 (position 3095983)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 3122764
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GACTCAACTGGAGGACCAGGATACAGAGATCGAGAGGCTGAAGGCCGAGG[T/G]TCGTTTATCGTCTTCAGCTCAATCCAAGGTTGTCAGGTGCCAGAAAAAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41572
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081794 Nonsense 751 1028 15 21
Genomic Location (Zv9):
Chromosome 10 (position 3115572)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 3103175
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCCTCCCCCATCCACTCCCGCAAGCTGTCCCTCAGCTCTCCTGTCAGCTG[T/A]AAGGCTGGAGCTCTGGATCTCTCCACCTCCACCTTCTCTGCAGCCAGCAG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link