si:ch1073-193f3.1

Ensembl ID:
ENSDARG00000075048
ZFIN ID:
ZDB-GENE-100922-9
Human Orthologue:
LONRF1
Human Description:
LON peptidase N-terminal domain and ring finger 1 [Source:HGNC Symbol;Acc:26302]
Mouse Orthologue:
Lonrf1
Mouse Description:
LON peptidase N-terminal domain and ring finger 1 Gene [Source:MGI Symbol;Acc:MGI:3609241]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa19088 Essential Splice Site Mutation detected in F1 DNA During 2017
sa9353 Essential Splice Site Mutation detected in F1 DNA During 2017
sa35722 Essential Splice Site, Missense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa19088
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109513   None 311 None 8
ENSDART00000109935 Essential Splice Site 192 605 5 13
ENSDART00000114153   None 588 None 14
ENSDART00000135556   None 596 None 12
ENSDART00000137512   None 539 None 11
ENSDART00000109513   None 311 None 8
ENSDART00000109935 Essential Splice Site 192 605 5 13
ENSDART00000114153   None 588 None 14
ENSDART00000135556   None 596 None 12
ENSDART00000137512   None 539 None 11
Genomic Location (Zv9):
Chromosome 14 (position 35164196)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 33737234
KASP Assay ID:
2260-7752.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGATAATAGCAACATGCAATACATCAATAAAAGATGTATAATTCTTGTA[T/G]AATATGCAGATCTTGGAAGCAGAGGGCATGGCTGTGCCGGAGGAAGTTCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9353
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109513   None 311 None 8
ENSDART00000109935 Essential Splice Site 192 605 5 13
ENSDART00000114153   None 588 None 14
ENSDART00000135556   None 596 None 12
ENSDART00000137512   None 539 None 11
ENSDART00000109513   None 311 None 8
ENSDART00000109935 Essential Splice Site 192 605 5 13
ENSDART00000114153   None 588 None 14
ENSDART00000135556   None 596 None 12
ENSDART00000137512   None 539 None 11
Genomic Location (Zv9):
Chromosome 14 (position 35164196)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 33737234
KASP Assay ID:
2260-7752.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATGATAATAGCAACATGCAATACATCAATAAAAGATGTATMATTCTTGTA[T/G]AATATGCAGATCTTGGAAGCAGAGGGCATGGCTGTGCCGGAGGAAGTTCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35722
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Essential Splice Site, Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109513   None 311 None 8
ENSDART00000109935 Missense 212 605 5 13
ENSDART00000114153 Essential Splice Site 176 588 5 14
ENSDART00000135556 Missense 203 596 4 12
ENSDART00000137512   None 539 None 11
Genomic Location (Zv9):
Chromosome 14 (position 35164259)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 33737297
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGGAAGCAGAGGGCATGGCTGTGCCGGAGGAAGTTCCACGGATCCTGCA[T/A]GTTGTGTCTGAGTTTTTGCAGGATCCCTGTCCAATCACCAGCTCCGTAAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link