LOC100004674

Ensembl ID:
ENSDARG00000075046
Human Orthologue:
RNF151
Human Description:
ring finger protein 151 [Source:HGNC Symbol;Acc:23235]
Mouse Orthologue:
Rnf151
Mouse Description:
ring finger protein 151 Gene [Source:MGI Symbol;Acc:MGI:1914754]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa10594 Essential Splice Site Available for shipment Available now
sa7696 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa10594
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108745 Essential Splice Site 83 243 4 4
Genomic Location:
Chromosome 12 (position 19490270)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATAATGTCARCAAAATWTGAGCCTGAAATGTCACTGTGTGTCTGCTTTTA[G/A]TGTCGAAATGGACAGCAGGGCTGCAGGGCGACTTTCCCGCTTTCKAAYGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7696
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108745 Nonsense 170 243 4 4
Genomic Location:
Chromosome 12 (position 19490532)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACCAGACCCAWCACAACTGCTACAGAGAGCTGCAGCAACGCTACTTWGCT[G/T]AGCGTCGGAAGCAGAGAGCCATCGCAGCCAACCTGCGCAGGAAGATGCAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/0aa6dx09