ENSDARG00000075038

Ensembl ID:
ENSDARG00000075038
Human Orthologues:
MUC12, MUC4
Human Descriptions:
mucin 12, cell surface associated [Source:HGNC Symbol;Acc:7510]
mucin 4, cell surface associated [Source:HGNC Symbol;Acc:7514]
Mouse Orthologue:
Muc4
Mouse Description:
mucin 4 Gene [Source:MGI Symbol;Acc:MGI:2153525]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa39352 Nonsense Mutation detected in F1 DNA During 2016
sa32364 Nonsense Mutation detected in F1 DNA During 2016
sa24039 Essential Splice Site Available for shipment Available now
sa43728 Essential Splice Site Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa39352
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114796 Nonsense 1493 2228 5 8
Genomic Location:
Chromosome 21 (position 43713143)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCAGTCAAGAACAACTGCACCTAATGGCCCTTTCACCATCATAGATCTTT[T/A]GGGTTCAAAGACATCTGTTCCTGTTGATTCTACAACTGCTGCAATTCCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32364
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114796 Nonsense 2081 2228 5 8
Genomic Location:
Chromosome 21 (position 43711380)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTAAAGCATCTACTGGTTCAGCAATGCCAGGGGAGGTATTTGTTGTTCTG[C/T]AGATTCGTTTACAAACACAATATATTGATGCTTACAATAACCCTGCTTCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24039
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114796 Essential Splice Site 2110 2228 5 8
ENSDART00000114796 Essential Splice Site 2110 2228 5 8
Genomic Location:
Chromosome 21 (position 43711289)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCCTGCTTCCGTGGAGTACCAGAGTCTGTCCAGAAACATCACTATTGAGG[T/C]AATCCAACCAACAATTATTTTCTTACTTATGAAGACTANNNNNNNNNNNN
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43728
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114796 Essential Splice Site 2110 2228 5 8
ENSDART00000114796 Essential Splice Site 2110 2228 5 8
Genomic Location:
Chromosome 21 (position 43711289)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCCTGCTTCCGTGGAGTACCAGAGTCTGTCCAGAAACATCACTATTGAGG[T/C]AATCCAACCAACAATTATTTTCTTACTTATGAAGACTANNNNNNNNNNNN
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link