raver2

Ensembl ID:
ENSDARG00000075034
ZFIN ID:
ZDB-GENE-090713-1
Description:
Ribonucleoprotein PTB-binding 2 [Source:UniProtKB/TrEMBL;Acc:B7TXW9]
Human Orthologue:
RAVER2
Human Description:
ribonucleoprotein, PTB-binding 2 [Source:HGNC Symbol;Acc:25577]
Mouse Orthologue:
Raver2
Mouse Description:
ribonucleoprotein, PTB-binding 2 Gene [Source:MGI Symbol;Acc:MGI:2443623]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa40716 Essential Splice Site Mutation detected in F1 DNA During 2016
sa40715 Nonsense Mutation detected in F1 DNA During 2016
sa20722 Essential Splice Site Available for shipment Available now
sa26764 Essential Splice Site Mutation detected in F1 DNA During 2016
sa1732 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa40716
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111837 Essential Splice Site 108 862 1 15
Genomic Location (Zv9):
Chromosome 6 (position 31268158)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 31589074
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACAGGAGGAAGATCCTTATTAAGAACCTGCCACAGGACACAACCAACCAG[G/T]TAGAGAGATTTACATACATCAGCCTGACAGGTGAAACTTAACCTGGTCAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40715
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111837 Nonsense 310 862 4 15
Genomic Location (Zv9):
Chromosome 6 (position 31175572)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 31496488
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGGGAAGTCCGGTCCGGGGTTTTGCTGTAGTGGAGTATGAAACAGCAGAG[C/T]AGGCTGAAGCTGTGCTGCTGGAGATGGACAGACAGCTTATCCAGGGTCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20722
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111837 Essential Splice Site 589 862 9 15
Genomic Location (Zv9):
Chromosome 6 (position 31154513)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 31475429
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCCAGCCAATCATCACAGCGCAAGTGTGCAGACTAGTACTTCCGTTACGG[T/C]GAGCCTGCTTTCCCTCATAGATAAAACTGAGTATTTTTGGTCTTTTCAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa26764
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111837 Essential Splice Site 676 862 11 15
Genomic Location (Zv9):
Chromosome 6 (position 31147528)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 31468444
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGCGCTCCTGCAGAATACACTCAGCAGTACACTCAGCAATACACACAGG[T/C]AACTACAACACACACACATGAGAAACTGCACAAATATAAAATGATGCAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1732
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111837 Nonsense 718 862 13 15
Genomic Location (Zv9):
Chromosome 6 (position 31133738)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 31454654
KASP Assay ID:
554-1677.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TAAGAAATGTGTGTGTTTATGTTCCACAGGTGGTGGTCACCTCCWCATAC[G/T]GAGACTACAGCTCCTACATGCACGCTGTCAGTCAGTACTATTCTCAGACG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link