raver2

Ensembl ID:
ENSDARG00000075034
ZFIN ID:
ZDB-GENE-090713-1
Description:
Ribonucleoprotein PTB-binding 2 [Source:UniProtKB/TrEMBL;Acc:B7TXW9]
Human Orthologue:
RAVER2
Human Description:
ribonucleoprotein, PTB-binding 2 [Source:HGNC Symbol;Acc:25577]
Mouse Orthologue:
Raver2
Mouse Description:
ribonucleoprotein, PTB-binding 2 Gene [Source:MGI Symbol;Acc:MGI:2443623]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa20722 Essential Splice Site Mutation detected in F1 DNA During 2015
sa26764 Essential Splice Site Mutation detected in F1 DNA During 2015
sa1732 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa20722
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2015.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111837 Essential Splice Site 589 862 9 15
Genomic Location:
Chromosome 6 (position 31154513)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCCAGCCAATCATCACAGCGCAAGTGTGCAGACTAGTACTTCCGTTACGG[T/C]GAGCCTGCTTTCCCTCATAGATAAAACTGAGTATTTTTGGTCTTTTCAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa26764
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2015.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111837 Essential Splice Site 676 862 11 15
Genomic Location:
Chromosome 6 (position 31147528)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGCGCTCCTGCAGAATACACTCAGCAGTACACTCAGCAATACACACAGG[T/C]AACTACAACACACACACATGAGAAACTGCACAAATATAAAATGATGCAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1732
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111837 Nonsense 718 862 13 15
Genomic Location:
Chromosome 6 (position 31133738)
KASP Assay ID:
554-1677.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TAAGAAATGTGTGTGTTTATGTTCCACAGGTGGTGGTCACCTCCWCATAC[G/T]GAGACTACAGCTCCTACATGCACGCTGTCAGTCAGTACTATTCTCAGACG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/94ghab5g