raver2

Ensembl ID:
ENSDARG00000075034
ZFIN ID:
ZDB-GENE-090713-1
Description:
Ribonucleoprotein PTB-binding 2 [Source:UniProtKB/TrEMBL;Acc:B7TXW9]
Human Orthologue:
RAVER2
Human Description:
ribonucleoprotein, PTB-binding 2 [Source:HGNC Symbol;Acc:25577]
Mouse Orthologue:
Raver2
Mouse Description:
ribonucleoprotein, PTB-binding 2 Gene [Source:MGI Symbol;Acc:MGI:2443623]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa20722 Essential Splice Site Mutation detected in F1 DNA During 2014
sa1732 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa20722
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111837 Essential Splice Site 589 862 9 15
Genomic Location:
Chromosome 6 (position 31154513)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCCAGCCAATCATCACAGCGCAAGTGTGCAGACTAGTACTTCCGTTACGG[T/C]GAGCCTGCTTTCCCTCATAGATAAAACTGAGTATTTTTGGTCTTTTCAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1732
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111837 Nonsense 718 862 13 15
Genomic Location:
Chromosome 6 (position 31133738)
KASP Assay ID:
554-1677.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TAAGAAATGTGTGTGTTTATGTTCCACAGGTGGTGGTCACCTCCWCATAC[G/T]GAGACTACAGCTCCTACATGCACGCTGTCAGTCAGTACTATTCTCAGACG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/94ghab5g