cdc123

Ensembl ID:
ENSDARG00000075025
ZFIN ID:
ZDB-GENE-040426-1680
Description:
Cell division cycle protein 123 homolog [Source:UniProtKB/Swiss-Prot;Acc:Q6PC40]
Human Orthologue:
CDC123
Human Description:
cell division cycle 123 homolog (S. cerevisiae) [Source:HGNC Symbol;Acc:16827]
Mouse Orthologue:
Cdc123
Mouse Description:
cell division cycle 123 homolog (S. cerevisiae) Gene [Source:MGI Symbol;Acc:MGI:2138811]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa11422 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa11422
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111986 Nonsense 194 348 9 13
Genomic Location:
Chromosome 4 (position 7061250)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATGGCATATATACTGAGATMATGTTTRATATTATTTTAGCGATATGTCAG[C/T]GAGATTATACACAACATTACCAGCACATCGGCAAACAAGAGGCCAGCATC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/dmxcbkrt