grinl1a

Ensembl ID:
ENSDARG00000075017
ZFIN ID:
ZDB-GENE-041111-91
Human Orthologues:
AC090651.1, GCOM1
Human Descriptions:
GRINL1A complex locus protein 1 [Source:UniProtKB/Swiss-Prot;Acc:P0CAP1]
GRINL1A complex locus [Source:HGNC Symbol;Acc:26424]
Mouse Orthologues:
Gcom1, RP23-357O18.3
Mouse Description:
GRINL1A complex locus Gene [Source:MGI Symbol;Acc:MGI:2142908]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa17153 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa17153
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110265 Nonsense 365 584 10 14
Genomic Location:
Chromosome 7 (position 53849762)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTGATTGTGAGCAACGCTTGCRTGGTTTGGATGAAACWGACCATGCAGAC[A/T]AAGCTGCGGCCAAACAGTAAGTAACATCTAATTTATGTTCTGAAAATATT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Coronary heart disease: Genome-wide association study of coronary heart disease and its risk factors in 8,090 African Americans: the NHLBI CARe Project. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/1du4n0dg