A8KBA7_DANRE

Ensembl ID:
ENSDARG00000075015
Description:
LOC100000079 protein [Source:UniProtKB/TrEMBL;Acc:A8KBA7]
Human Orthologue:
HEBP2
Human Description:
heme binding protein 2 [Source:HGNC Symbol;Acc:15716]
Mouse Orthologue:
Hebp2
Mouse Description:
heme binding protein 2 Gene [Source:MGI Symbol;Acc:MGI:1860084]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa20144 Essential Splice Site Mutation detected in F1 DNA During 2014
sa12643 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa20144
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115243 Essential Splice Site 16 231 1 8
Genomic Location:
Chromosome 3 (position 54123206)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCACACGTTTCCTCTCTGCTCAGCCTGAAGCTACAAAATTCTGCAACAT[G/A]TGAGTACAGAAGCTTTTACTTTCCTGCACTGCTGCAAAAACACCATTTAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12643
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115243 Essential Splice Site None 231 7 8
Genomic Location:
Chromosome 3 (position 54114442)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGGGTGAGCCTGTGTGTCCTAAGAGTGAATAACTTCAAGTATTKGAGAGG[T/A]AAATAAGAAKTCTGATTAAYGAAACAATTGAAGAACTGTGTTTAATGTCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/xg9pqzlf