usp45

Ensembl ID:
ENSDARG00000075013
ZFIN ID:
ZDB-GENE-100211-2
Human Orthologue:
USP45
Human Description:
ubiquitin specific peptidase 45 [Source:HGNC Symbol;Acc:20080]
Mouse Orthologue:
Usp45
Mouse Description:
ubiquitin specific petidase 45 Gene [Source:MGI Symbol;Acc:MGI:101850]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa13100 Nonsense Available for shipment Available now
sa12916 Essential Splice Site Available for shipment Available now
sa28695 Essential Splice Site Mutation detected in F1 DNA During 2015

Mutation Details

Allele Name:
sa13100
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112360 Nonsense 148 830 5 23
ENSDART00000137232   None 803 None 18
Genomic Location:
Chromosome 16 (position 35036219)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGCAAAAGCAGTCAGCAAAAGCCACCTCAGGTAATTAATCCACAGAAAAA[C/T]AAGGAGAACAATGTTAAANNNNNNNNAATTTTAGGAACATGAYAYATTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12916
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112360 Essential Splice Site 319 830 12 23
ENSDART00000137232 Essential Splice Site 313 803 9 18
Genomic Location:
Chromosome 16 (position 35012136)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGAATTGCTGCATTACCYCCTGGACTCTATGAGAGTGGAGGAGACAAAGG[T/G]GAGTGTGTGAGATCGTGTNNTTTTTTNCCTTCTCTTCTATTAATAAAGATTWA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa28695
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2015.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112360 Essential Splice Site 779 830 None 23
ENSDART00000137232   751 803 17 18
Genomic Location:
Chromosome 16 (position 34993987)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGCGAGGTGGGCATTATGCAGCCTATGTAAAGGTCCGAACACCTCAACG[T/A]AAACCTGAGCAGCGCCGGAACCAGTCAGGTACAAAGCTGCATGGGCAGCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/sv0djq1g