usp45

Ensembl ID:
ENSDARG00000075013
ZFIN ID:
ZDB-GENE-100211-2
Human Orthologue:
USP45
Human Description:
ubiquitin specific peptidase 45 [Source:HGNC Symbol;Acc:20080]
Mouse Orthologue:
Usp45
Mouse Description:
ubiquitin specific petidase 45 Gene [Source:MGI Symbol;Acc:MGI:101850]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa13100 Nonsense Available for shipment Available now
sa12916 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa13100
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112360 Nonsense 148 830 5 23
ENSDART00000137232 None None 803 None 18
Genomic Location:
Chromosome 16 (position 35036219)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGCAAAAGCAGTCAGCAAAAGCCACCTCAGGTAATTAATCCACAGAAAAA[C/T]AAGGAGAACAATGTTAAANNNNNNNNAATTTTAGGAACATGAYAYATTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12916
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112360 Essential Splice Site 319 830 12 23
ENSDART00000137232 Essential Splice Site 313 803 9 18
Genomic Location:
Chromosome 16 (position 35012136)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGAATTGCTGCATTACCYCCTGGACTCTATGAGAGTGGAGGAGACAAAGG[T/G]GAGTGTGTGAGATCGTGTNNTTTTTTNCCTTCTCTTCTATTAATAAAGATTWA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/sv0djq1g