usp45

Ensembl ID:
ENSDARG00000075013
ZFIN ID:
ZDB-GENE-100211-2
Human Orthologue:
USP45
Human Description:
ubiquitin specific peptidase 45 [Source:HGNC Symbol;Acc:20080]
Mouse Orthologue:
Usp45
Mouse Description:
ubiquitin specific petidase 45 Gene [Source:MGI Symbol;Acc:MGI:101850]

Alleles

There are 6 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa13100 Nonsense Available for shipment Available now
sa12916 Essential Splice Site Available for shipment Available now
sa42767 Essential Splice Site Mutation detected in F1 DNA During 2016
sa36194 Nonsense Mutation detected in F1 DNA During 2016
sa36193 Essential Splice Site Mutation detected in F1 DNA During 2016
sa28695 Essential Splice Site Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa13100
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112360 Nonsense 148 830 5 23
ENSDART00000137232   None 803 None 18
Genomic Location:
Chromosome 16 (position 35036219)
KASP Assay ID:
2260-9951.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGCAAAAGCAGTCAGCAAAAGCCACCTCAGGTAATTAATCCACAGAAAAA[C/T]AAGGAGAACAATGTTAAANNNNNNNNAATTTTAGGAACATGAYAYATTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12916
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112360 Essential Splice Site 319 830 12 23
ENSDART00000137232 Essential Splice Site 313 803 9 18
Genomic Location:
Chromosome 16 (position 35012136)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGAATTGCTGCATTACCYCCTGGACTCTATGAGAGTGGAGGAGACAAAGG[T/G]GAGTGTGTGAGATCGTGTNNTTTTTTNCCTTCTCTTCTATTAATAAAGATTWA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42767
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112360 Essential Splice Site 346 830 13 23
ENSDART00000137232 Essential Splice Site 340 803 10 18
Genomic Location:
Chromosome 16 (position 35001391)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAACCCCACAGAGAAGACTGCAGACGAGGAGACCAAACGACAAGTGAAGG[G/A]TGATTCAGCTCTGCTTCCGTCACATCACTCAAAACAATAGTGCCATCTAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36194
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112360 Nonsense 532 830 19 23
ENSDART00000137232 Nonsense 504 803 14 18
Genomic Location:
Chromosome 16 (position 34997625)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGCAGGACAGCAGTAACGATGCAGACAGCGAGGCCTCTGAAAGTGAATG[G/A]TCTCCCCGAATCCCATCAGTGTCCAGTCACAGCAGCACATCAGATAAAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36193
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112360 Essential Splice Site 742 830 None 23
ENSDART00000137232 Essential Splice Site 714 803 None 18
Genomic Location:
Chromosome 16 (position 34994102)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTGAGTTTACAGTGTTCTTCCCAATATAGATTTGTTGTTTATGTTTGGC[A/T]GAACCTCGGGTCAGGAGAGCGTGTGCTTTACAGTTTGTATGGCATTGTGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa28695
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112360 Essential Splice Site 779 830 None 23
ENSDART00000137232   751 803 17 18
Genomic Location:
Chromosome 16 (position 34993987)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGCGAGGTGGGCATTATGCAGCCTATGTAAAGGTCCGAACACCTCAACG[T/A]AAACCTGAGCAGCGCCGGAACCAGTCAGGTACAAAGCTGCATGGGCAGCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link