NP_001161371.1

Ensembl ID:
ENSDARG00000075012
Description:
glycine receptor alpha 2 [Source:RefSeq peptide;Acc:NP_001161371]
Human Orthologue:
GLRA2
Human Description:
glycine receptor, alpha 2 [Source:HGNC Symbol;Acc:4327]
Mouse Orthologue:
Glra2
Mouse Description:
glycine receptor, alpha 2 subunit Gene [Source:MGI Symbol;Acc:MGI:95748]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa21617 Nonsense Available for shipment Available now
sa7286 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa21617
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000066192 Nonsense 39 427 2 10
ENSDART00000105620 Nonsense 39 384 2 8
Genomic Location (Zv9):
Chromosome 9 (position 56947384)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 55355108
KASP Assay ID:
2260-2638.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCAGGACTACAGGGTGAACATTTTCCTCCGGCAGAAGTGGAACGACCCT[C/T]GACTGGCCTACAGCGAGTATCCGGACTCGTCTCTGGATCTGGACCCGTCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7286
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000066192 Essential Splice Site 422 427 9 10
ENSDART00000105620   382 384 8 8
Genomic Location (Zv9):
Chromosome 9 (position 56926741)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 55334465
KASP Assay ID:
554-4472.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAYGTTTTTTACTGGATCACGTATAAGATCATCAGACACGAGAGCGCAAG[G/A]AAAGACTAGAGATTACRTCATTTATYTGCTGACTTTCACCTGGATTAKTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link