ap4e1

Ensembl ID:
ENSDARG00000075000
ZFIN ID:
ZDB-GENE-061221-3
Human Orthologue:
AP4E1
Human Description:
adaptor-related protein complex 4, epsilon 1 subunit [Source:HGNC Symbol;Acc:573]
Mouse Orthologue:
Ap4e1
Mouse Description:
adaptor-related protein complex AP-4, epsilon 1 Gene [Source:MGI Symbol;Acc:MGI:1336993]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa32509 Essential Splice Site Available for shipment Available now
sa19357 Nonsense Mutation detected in F1 DNA During 2016
sa11955 Nonsense Available for shipment Available now
sa8426 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa32509
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109284 Essential Splice Site 432 1121 12 21
Genomic Location (Zv9):
Chromosome 25 (position 4883640)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 4744882
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATATAACTACATCCTATTGTTGCACGTGAGTTTTTCTATCAAAACCCTTA[C/T]GTTTGCTCCAGACAACTCCTGGTTTATTCAGACCATGAATGATGTTTTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19357
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109284 Nonsense 766 1121 17 21
ENSDART00000109284 Nonsense 766 1121 17 21
Genomic Location (Zv9):
Chromosome 25 (position 4890209)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 4751451
KASP Assay ID:
554-6224.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AACGCAAACCAACGACAAACAGCAGCTGGCTTCCTCTTTGTTTGTTGGTT[T/A]GAGTACGCAGAGTTCCACATCTTTGGTGAGAAAATTGTTTTATGAACAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11955
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109284 Nonsense 766 1121 17 21
ENSDART00000109284 Nonsense 766 1121 17 21
Genomic Location (Zv9):
Chromosome 25 (position 4890209)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 4751451
KASP Assay ID:
554-6224.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AACGCAAAYCAACGACAAACAGCAGCTGGCTTCCTCTTTGTTTGTTGGYT[T/A]GAGTACGCAGAGTTCCACATCTTTGGTGAGAAAWTTGTTTTATGAACAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8426
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109284 Nonsense 877 1121 18 21
Genomic Location (Zv9):
Chromosome 25 (position 4892523)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 4753765
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CRTCTCAGATACTGGGCAGTGATATGGTGATAGTGCGGCCCAACACAATA[C/T]AACACAAKCCGTCCACGTCTTCAGACCTGACCACTCTCTTACCTGCAGAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link