eif2b5

Ensembl ID:
ENSDARG00000074995
ZFIN ID:
ZDB-GENE-030131-5364
Description:
translation initiation factor eIF-2B subunit epsilon [Source:RefSeq peptide;Acc:NP_001107069]
Human Orthologue:
EIF2B5
Human Description:
eukaryotic translation initiation factor 2B, subunit 5 epsilon, 82kDa [Source:HGNC Symbol;Acc:3261]
Mouse Orthologue:
Eif2b5
Mouse Description:
eukaryotic translation initiation factor 2B, subunit 5 epsilon Gene [Source:MGI Symbol;Acc:MGI:24461

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa3390 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa3390
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110416 Nonsense 354 617 7 13
Genomic Location:
Chromosome 2 (position 3063642)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATGGAGGAAAACGTGCTCATCGGCAGGAATACGGTGATCGGAGCAAACTG[C/A]AGCATATCCAATACAGTGATCGGCGCAAACTGTGTCATCGGTAATGTCTG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/2ddwf5nd