B2BJ88_DANRE

Ensembl ID:
ENSDARG00000074992
Description:
Putative class I cytokine receptor 31.2 [Source:UniProtKB/TrEMBL;Acc:A8WHA2]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa17544 Essential Splice Site Available for shipment Available now
sa40139 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa17544
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108714   None 421 None 10
ENSDART00000114686 Essential Splice Site 301 368 9 10
Genomic Location:
Chromosome 3 (position 42606685)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAAACCAAGTTGAGGTTATTAATCCAGACTTCGAGGAGGGAAAGAAATCG[T/C]ATGTTATTTTATTTATACACTGTAATCATGCTCAGTGTCGTTCTATGTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40139
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108714 Nonsense 394 421 10 10
ENSDART00000114686 Nonsense 341 368 10 10
Genomic Location:
Chromosome 3 (position 42606889)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATAATGGCCAGGCCGTCTGTGATTCTGGTAGCAATCCGGTGCAAGACATC[C/T]GATCACAACTTGATATTGCAATAGCTCTAGATTTTTTACGGTTGAAATGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link