CDH19

Ensembl ID:
ENSDARG00000074991
Description:
cadherin 19, type 2 [Source:HGNC Symbol;Acc:1758]
Human Orthologue:
CDH19
Human Description:
cadherin 19, type 2 [Source:HGNC Symbol;Acc:1758]
Mouse Orthologue:
Cdh19
Mouse Description:
cadherin 19, type 2 Gene [Source:MGI Symbol;Acc:MGI:3588198]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa16067 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa16067
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114853 Essential Splice Site 69 693 1 11
Genomic Location:
Chromosome 24 (position 12604)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCAGATATTTGTTGAAGAGGAAGATTCAACCCCGARGAACATTGGTCAGG[T/C]ATTCATTCACAAGCAGCTCTTACACATACACATGCATACAGGTGCTGGTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/lpjyb1g5