LOC566937

Ensembl ID:
ENSDARG00000074990
Human Orthologue:
BEND4
Human Description:
BEN domain containing 4 [Source:HGNC Symbol;Acc:23815]
Mouse Orthologue:
Bend4
Mouse Description:
BEN domain containing 4 Gene [Source:MGI Symbol;Acc:MGI:3648414]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa35752 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa35752
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114029 Essential Splice Site 122 511 1 6
Genomic Location (Zv9):
Chromosome 14 (position 48152556)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 46226933
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGTCGGCTTCATTTGGCAGCCCGCGGAGGGTCGCGGTCGCGGGCCAAGAG[T/C]CCGGTAGACTCCGCGCCGAGATCAGCCACCAGACTCCAGACTGCACCTAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link