LOC568283

Ensembl ID:
ENSDARG00000074979
Human Orthologue:
LARP4
Human Description:
La ribonucleoprotein domain family, member 4 [Source:HGNC Symbol;Acc:24320]
Mouse Orthologue:
Larp4
Mouse Description:
La ribonucleoprotein domain family, member 4 Gene [Source:MGI Symbol;Acc:MGI:2443114]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa33915 Nonsense Mutation detected in F1 DNA During 2017
sa33914 Essential Splice Site Mutation detected in F1 DNA During 2017
sa31528 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa33915
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110380 Nonsense 43 726 2 16
Genomic Location (Zv9):
Chromosome 6 (position 39581720)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 39653320
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CACCAACCAGCCAGGCTCCAGAGGCAGCCACAGAGACATGCCATTGGCCA[C/T]AAGCGGATCATGTCTCCACTGAGGAGATGGAGGGTATGTGCGCTGATTAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33914
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110380 Essential Splice Site 542 726 14 16
Genomic Location (Zv9):
Chromosome 6 (position 39570522)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 39642122
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCCAGCACTGAAGCCTCCCACCACTAAAGTGGATCCACCTGTAGCTAGG[T/G]ACGACATGCATGTGCAATTGTATTCTGTGCTTTAACAAATTTACTATTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31528
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110380 Nonsense 658 726 16 16
Genomic Location (Zv9):
Chromosome 6 (position 39568271)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 39639871
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTACGTGAACTTCGTGCCAACAAGGTGGATGGTCCAGCCTCATCCCGCTG[C/A]AGCCCTTGGGACAAATTAGAGAAAGGTGAGAGTCGGACGTCCAGAGAGCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link