si:rp71-15i12.1

Ensembl ID:
ENSDARG00000074974
ZFIN ID:
ZDB-GENE-100922-163
Human Orthologue:
CEP192
Human Description:
centrosomal protein 192kDa [Source:HGNC Symbol;Acc:25515]
Mouse Orthologue:
Cep192
Mouse Description:
centrosomal protein 192 Gene [Source:MGI Symbol;Acc:MGI:1918049]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa22766 Nonsense Mutation detected in F1 DNA During 2014
sa875 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa22766
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110803 Nonsense 487 979 11 22
ENSDART00000129691 None None 102 None 3
ENSDART00000144590 Nonsense 530 1168 12 26
Genomic Location:
Chromosome 16 (position 11807951)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGCAAAAGCAATGTAATTCTGGAGAATTTGCGGAAACATTCTGATGGTTA[T/A]GTGGCCACACTGAGAGGGGTACAGTCTGGGCATGTCAGTAAGCTCTGTAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa875
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110803 Nonsense 810 979 18 22
ENSDART00000129691 None None 102 None 3
ENSDART00000144590 Nonsense 857 1168 18 26
Genomic Location:
Chromosome 16 (position 11801188)
KASP Assay ID:
554-0777.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCTCCATGCTGCCGTGGAATGGACAGATCTATATACAGTGTGGTGATCAA[C/T]AGAAGGTACTAGTTTCCCCCCTTATTTATCAGACATAAAACAAAATGTTA
Associated Phenotype:

This allele has been associated with this phenotype by genetic linkage analysis and may not be causal. See FAQs for more info.

Control on top; Mutant below; 5 dpf

Control on top; Mutant below; 5 dpf

zoom

Stage Entity Entity Quality Tag
Larval:Day 5
ZFS:0000037
cranium
ZFA:0000737

quality
PATO:0000001
abnormal
PATO:0000460
Larval:Day 5
ZFS:0000037
larval locomotory behavior
GO:0008345

disrupted
PATO:0001507
abnormal
PATO:0000460
Larval:Day 5
ZFS:0000037
liver
ZFA:0000123

quality
PATO:0000001
abnormal
PATO:0000460
Larval:Day 5
ZFS:0000037
swim bladder
ZFA:0000076

aplastic
PATO:0001483
abnormal
PATO:0000460
Larval:Day 5
ZFS:0000037
trunk
ZFA:0001115
anterior region
BSPO:0000071
bent
PATO:0000617
abnormal
PATO:0000460
Larval:Day 5
ZFS:0000037
yolk
ZFA:0000084

increased size
PATO:0000586
abnormal
PATO:0000460
Transcriptome Profiling Preview:
View complete transcriptome profile
Region 3' end position 3' end strand Adjusted p-value Log2 fold change (mutant/sibling) Closest Ensembl gene 3' end Gene name e74 Ensembl Gene ID
22:7481301-7482127 7482127 1 1.82 × 10-40 -2.2 45 CELA1 (1 of 7) ENSDARG00000017314
7:36532801-36533246 36533246 1 2.37 × 10-39 -2.2 0 ctrb1 ENSDARG00000090428
16:27320047-27320500 27320047 -1 2.93 × 10-32 -2.3 -2 try ENSDARG00000042993
16:28258201-28259130 28259130 1 1.11 × 10-28 -2.2 -1 si:ch73-103b2.3 ENSDARG00000073742
24:4835110-4836100 4835110 -1 1.31 × 10-27 -2.5 1 cpb1 ENSDARG00000045442

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/emyemj6p