LOC100003720

Ensembl ID:
ENSDARG00000074968
Human Orthologue:
GRINL1A
Human Description:
glutamate receptor, ionotropic, N-methyl D-aspartate-like 1A [Source:HGNC Symbol;Acc:14862]
Mouse Orthologue:
Grinl1a
Mouse Description:
glutamate receptor, ionotropic, N-methyl D-aspartate-like 1A Gene [Source:MGI Symbol;Acc:MGI:107282]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa26969 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa26969
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108782 Nonsense 71 344 2 4
Genomic Location (Zv9):
Chromosome 7 (position 31619837)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 30012179
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGTTTGTGGAGAAAGTGCATCTTGCACTCGGGCATCTGGAGGAGGAGGAG[C/T]GAAAGCAAGCAGGTTTAATCTCTGTCCGGACAGAGTTTCAGTCGAAATAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link