nup98

Ensembl ID:
ENSDARG00000074955
ZFIN ID:
ZDB-GENE-040426-1180
Description:
Zgc:113968 protein [Source:UniProtKB/TrEMBL;Acc:Q0VFW5]
Human Orthologue:
NUP98
Human Description:
nucleoporin 98kDa [Source:HGNC Symbol;Acc:8068]
Mouse Orthologue:
Nup98
Mouse Description:
nucleoporin 98 Gene [Source:MGI Symbol;Acc:MGI:109404]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa29656 Nonsense Mutation detected in F1 DNA During 2017
sa17239 Essential Splice Site Available for shipment Available now
sa37372 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa29656
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000007981 Nonsense 287 359 8 9
ENSDART00000076867   None 451 None 10
ENSDART00000126383 Nonsense 287 358 8 10
ENSDART00000130950 Nonsense 287 1807 7 33
ENSDART00000136068 Nonsense 287 1803 8 33

The following transcripts of ENSDARG00000074955 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 21 (position 39226103)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 40366168
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGGTACAACCACAGGAAGTTTGTTTGCCCAGCCACAGCAGCAGCAGCAA[C/T]AACAGCAGCAAAATTCCAGTCTCTTCAAACCATTCGGCTCAGCCACCACC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17239
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000007981   None 359 None 9
ENSDART00000076867   None 451 None 10
ENSDART00000126383   None 358 None 10
ENSDART00000130950 Essential Splice Site 1399 1807 26 33
ENSDART00000136068 Essential Splice Site 1395 1803 27 33

The following transcripts of ENSDARG00000074955 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 21 (position 39204975)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 40345040
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTGTTGACTATTGTTATGCATTTTTTTGTWTATAYTTTTGTTTTTAATGA[A/C]GGTGTGGCAGTCTACAGACTGTTGTATAAACGTGTGCTCAGAGCTGGACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37372
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000007981   None 359 None 9
ENSDART00000076867   None 451 None 10
ENSDART00000126383   None 358 None 10
ENSDART00000130950 Nonsense 1476 1807 27 33
ENSDART00000136068 Nonsense 1472 1803 28 33

The following transcripts of ENSDARG00000074955 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 21 (position 39201749)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 40341814
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCCGTATATAGACGAACTGGAGTTGTTGGGTTTGGATGAAGACATGGAT[G/T]AGATCGATTCCAAAAAGCCACTCTACGACATCTGCTTCCACCTGCTCAAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link