NDST1 (2 of 2)

Ensembl ID:
ENSDARG00000074936
Description:
N-deacetylase/N-sulfotransferase (heparan glucosaminyl) 1 [Source:HGNC Symbol;Acc:7680]
Human Orthologue:
NDST1
Human Description:
N-deacetylase/N-sulfotransferase (heparan glucosaminyl) 1 [Source:HGNC Symbol;Acc:7680]
Mouse Orthologue:
Ndst1
Mouse Description:
N-deacetylase/N-sulfotransferase (heparan glucosaminyl) 1 Gene [Source:MGI Symbol;Acc:MGI:104719]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa39338 Nonsense Mutation detected in F1 DNA During 2017
sa1058 Essential Splice Site F2 line generated During 2017
sa19264 Nonsense Mutation detected in F1 DNA During 2017
sa23986 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa39338
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085748 Nonsense 136 861 2 19
Genomic Location (Zv9):
Chromosome 21 (position 32432485)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 33346922
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGCGCCTGGAAAAGGTGACATGCCAACACTCACAGATAAGAACCGGGGT[C/T]GATTCACGTTGGTCATCTACGAGAACATCCTCAAGTATGTCAACCTGGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1058
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085748 Essential Splice Site 559 861 12 19
Genomic Location (Zv9):
Chromosome 21 (position 32416500)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 33388000
KASP Assay ID:
554-0961.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTGTGAATTTGCTCGTTTCAGTGAAACTTCATTTCAGCTTATTTCTTACT[G/A]TTTCAGGACCCCTGTGAGGACAAAAGGCATAAAGACATCTGGTCTAAGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19264
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085748 Nonsense 598 861 13 19
Genomic Location (Zv9):
Chromosome 21 (position 32412075)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 33392425
KASP Assay ID:
2261-5852.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AACTGACCTGTTCACTTTCTTCTGTGTTTTTCAGGAACCACTGCCCTCTA[T/G]CTCTTTCTGAGCATGCATTCAGATTTGACCAGTAACTACCCCAGCAAAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23986
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085748 Nonsense 691 861 14 19
Genomic Location (Zv9):
Chromosome 21 (position 32405911)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 33398589
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAAATCATCACCATCCTTATCAACCCGGCTGACAGAGCCTATTCCTGGTA[T/G]CAGGTCAGTATCTCCGTAACTGCTCGTGTGTCATCTAGTCGCATCCAGGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link