sb:cb730

Ensembl ID:
ENSDARG00000074927
ZFIN ID:
ZDB-GENE-030829-51
Human Orthologue:
BUB1B
Human Description:
budding uninhibited by benzimidazoles 1 homolog beta (yeast) [Source:HGNC Symbol;Acc:1149]
Mouse Orthologue:
Bub1b
Mouse Description:
budding uninhibited by benzimidazoles 1 homolog, beta (S. cerevisiae) Gene [Source:MGI Symbol;Acc:MG

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa42842 Nonsense Mutation detected in F1 DNA During 2017
sa19158 Nonsense Mutation detected in F1 DNA During 2017
sa25034 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa42842
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110529 Nonsense 108 427 3 9
Genomic Location (Zv9):
Chromosome 17 (position 1513033)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 1955982
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCGGTCATGCGCTTTACAGCTGAGCAGAAATATCACAATGATGTCCGCTA[T/A]GTTGAACTCTGGATCCAGTTTGTGAGTGACTGACCTTAAAAGATTAGTGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19158
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110529 Nonsense 186 427 5 9
Genomic Location (Zv9):
Chromosome 17 (position 1516112)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 1959061
KASP Assay ID:
2261-0475.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGACCGCGTCTTATATTTGAAGTGGTTTTGTCTCCAGAGCTCTGCAGGCG[C/T]GAGTGTGTAGACAGATGATGACATCCATGACTGAACAACACAGAAATGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25034
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110529 Nonsense 287 427 6 9
Genomic Location (Zv9):
Chromosome 17 (position 1522508)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 1965457
KASP Assay ID:
554-7800.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGGAGCCCAGATTTGAGGTCTGGACGGCGCCGCCTGCTGCCCGAGCCAAA[G/T]AGAACCAGCAGAAAGTGGAGAAGTGGAGCAACGTGAAGGTGATCATTCCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link