etaa1

Ensembl ID:
ENSDARG00000074915
ZFIN ID:
ZDB-GENE-080204-12
Description:
Ewing tumor-associated antigen 1 [Source:RefSeq peptide;Acc:NP_001104627]
Human Orthologue:
ETAA1
Human Description:
Ewing tumor-associated antigen 1 [Source:HGNC Symbol;Acc:24648]
Mouse Orthologue:
Etaa1
Mouse Description:
Ewing's tumor-associated antigen 1 Gene [Source:MGI Symbol;Acc:MGI:1915395]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa19598 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa19598
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112177 Essential Splice Site 109 648 3 6
Genomic Location:
Chromosome 1 (position 52048415)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGTCCGAGCGGTGGATATATCTGACATTGCCAATCGGATCGCTCCTAAG[G/A]TTTGCTTGAGGAACATTATTAATTAAATCCATCAGAATGTCTCTAGTGAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/1cvjtt50