col6a1

Ensembl ID:
ENSDARG00000074908
ZFIN ID:
ZDB-GENE-070501-6
Human Orthologue:
COL6A1
Human Description:
collagen, type VI, alpha 1 [Source:HGNC Symbol;Acc:2211]
Mouse Orthologue:
Col6a1
Mouse Description:
collagen, type VI, alpha 1 Gene [Source:MGI Symbol;Acc:MGI:88459]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa949 Nonsense F2 line generated During 2016
sa21945 Essential Splice Site Available for shipment Available now
sa31842 Essential Splice Site Available for shipment Available now
sa21944 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa949
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110608 Nonsense 211 1010 7 38
Genomic Location (Zv9):
Chromosome 11 (position 34896002)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 33796939
KASP Assay ID:
554-0854.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTTCCCAGGACACCAGACTGTCTGTCATTGCCACAGATATAAACTACAGA[C/T]AGAACTTCACCGCTGCAGACAACTCCCGCTCCACACAAATGAGCACTATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21945
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110608 Essential Splice Site 368 1010 17 38
Genomic Location (Zv9):
Chromosome 11 (position 34884907)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 33785844
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AATCAGGGCCTAAAGGAGACCCCGGACAATATGGACGCAAAGGAGAACGA[G/A]TAAGAGATGAGAACGAGTCTGTGTTTGAGTAAAATGTGCATTTGGATATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31842
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110608 Essential Splice Site 520 1010 25 38
Genomic Location (Zv9):
Chromosome 11 (position 34865745)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 33766682
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGAAGACGGACCTCCAGGAAACGGGACGGAGGGTTGTGCTGGCTTTCAG[G/C]TACAGCAAATTTCTGTTGATTAAATGTTTTGCCAATTAAAGTCATATTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21944
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110608 Essential Splice Site 814 1010 38 38
Genomic Location (Zv9):
Chromosome 11 (position 34835832)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 33736769
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTCAGCATTTTGACTTCGAGATATTAATGGTTTGCTTCTTCCTCTTCTTC[A/G]GTTTCATTTAATGACAACACCGATGTCCTCATCATGATGGACAGCTCGGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link