itch

Ensembl ID:
ENSDARG00000074903
Human Orthologue:
ITCH
Human Description:
itchy E3 ubiquitin protein ligase homolog (mouse) [Source:HGNC Symbol;Acc:13890]
Mouse Orthologue:
Itch
Mouse Description:
itchy, E3 ubiquitin protein ligase Gene [Source:MGI Symbol;Acc:MGI:1202301]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa26849 Nonsense Mutation detected in F1 DNA During 2017
sa20834 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa26849
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111497 Nonsense 664 853 18 23
Genomic Location (Zv9):
Chromosome 6 (position 57454049)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 57507111
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGGAGTGTGGCTTGGAGATGTTTTTCTCTGTGGATAAGGAGATTCTGGGA[G/T]AGGTCACAACTCATGAACTCAAACCTGATGGAGGAAACATTCAGGTGACG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20834
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111497 Nonsense 761 853 20 23
Genomic Location (Zv9):
Chromosome 6 (position 57448285)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 57501347
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGGAACTCTATCTACAGACACTACGCTCGCAGCAGCAAACAGATCGTCTG[G/A]TTCTGGCAGGTCAGGCTGATCTGCCATTATAAATCTTCATGCATTATTTA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link