LOC556172

Ensembl ID:
ENSDARG00000074899
Human Orthologue:
TAOK2
Human Description:
TAO kinase 2 [Source:HGNC Symbol;Acc:16835]
Mouse Orthologue:
Taok2
Mouse Description:
TAO kinase 2 Gene [Source:MGI Symbol;Acc:MGI:1915919]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa998 Essential Splice Site Available for shipment Available now
sa19988 Essential Splice Site Mutation detected in F1 DNA During 2014
sa15028 Essential Splice Site Available for shipment Available now
sa19987 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa998
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114631 Essential Splice Site 44 1141 1 19
Genomic Location:
Chromosome 3 (position 21379525)
KASP Assay ID:
554-0902.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CACTGACCTCCGGGAGATTGGTCATGGCAGCTTTGGAGCRGTGTACTTTG[T/A]GAGCAAGCCACACCATTATTTATCAATGAATGTGTTTGAATGTAKGTTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19988
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114631 Essential Splice Site 715 1141 16 19
Genomic Location:
Chromosome 3 (position 21360424)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCGTCAGAAACATGCTGTGGAGGTCCGCCAGCAACCCAAAAGCTTAAAG[G/A]TGAAAGGATAGGGTTTTTTCTTTTTTCTTAATGTGGTGCATTCTACAATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15028
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114631 Essential Splice Site 850 1141 18 19
Genomic Location:
Chromosome 3 (position 21358063)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAGACCTGGAGCAGAGGGTGTCCATACGGAGAGCTCTTCTTGAACAAAGG[G/A]TAGGAGAGAGAGAAAAGGAATTGGACTGAATGTTGCTCGTTAAATAKGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19987
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114631 Nonsense 1008 1141 19 19
Genomic Location:
Chromosome 3 (position 21355933)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CATCTTCCTCGCATCATCACCTCCGCTACATCCCGCAGCAGTACCACCAT[C/T]AGAGCACCCCACACCTGTACCGCGACAGCCGAGAGAGAGAGTGGGGAAGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/c80mondz