LOC556172

Ensembl ID:
ENSDARG00000074899
Human Orthologue:
TAOK2
Human Description:
TAO kinase 2 [Source:HGNC Symbol;Acc:16835]
Mouse Orthologue:
Taok2
Mouse Description:
TAO kinase 2 Gene [Source:MGI Symbol;Acc:MGI:1915919]

Alleles

There are 7 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa998 Essential Splice Site Available for shipment Available now
sa40050 Essential Splice Site Mutation detected in F1 DNA During 2016
sa40049 Essential Splice Site Mutation detected in F1 DNA During 2016
sa19988 Essential Splice Site Mutation detected in F1 DNA During 2016
sa33147 Essential Splice Site Mutation detected in F1 DNA During 2016
sa15028 Essential Splice Site Available for shipment Available now
sa19987 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa998
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114631 Essential Splice Site 44 1141 1 19
Genomic Location (Zv9):
Chromosome 3 (position 21379525)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 21035916
KASP Assay ID:
554-0902.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CACTGACCTCCGGGAGATTGGTCATGGCAGCTTTGGAGCRGTGTACTTTG[T/A]GAGCAAGCCACACCATTATTTATCAATGAATGTGTTTGAATGTAKGTTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40050
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114631 Essential Splice Site 68 1141 2 19
Genomic Location (Zv9):
Chromosome 3 (position 21379373)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 21035764
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGTGGTGGCCATCAAGAAGATGTCGTTCAGTGGCAAACAGTCTAATGAGG[T/G]CAGAATCATAACCAGATGTATAATAGTAGGACTGGGGGTATGACAAAAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40049
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114631 Essential Splice Site 150 1141 5 19
Genomic Location (Zv9):
Chromosome 3 (position 21377233)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 21033624
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGTGCACTTCAGGGCCTTGCCTACCTTCACTCTCATAACATGATACACAG[G/A]TGAGATCACGGACCCTCAAGCTTTTCTGTTTATCTCTATTTTTATTTTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19988
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114631 Essential Splice Site 715 1141 16 19
Genomic Location (Zv9):
Chromosome 3 (position 21360424)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 21016815
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCGTCAGAAACATGCTGTGGAGGTCCGCCAGCAACCCAAAAGCTTAAAG[G/A]TGAAAGGATAGGGTTTTTTCTTTTTTCTTAATGTGGTGCATTCTACAATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33147
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114631 Essential Splice Site 790 1141 18 19
Genomic Location (Zv9):
Chromosome 3 (position 21358247)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 21014638
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTTCATTGGCTGCTTCTCTACTGATGTCCCACCTCTTTGTTTTCGTAACA[G/A]TTGCGATTGGATGAGACACAGGAGGATGAGTATCGAGCACTGCGCATGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15028
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114631 Essential Splice Site 850 1141 18 19
Genomic Location (Zv9):
Chromosome 3 (position 21358063)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 21014454
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAGACCTGGAGCAGAGGGTGTCCATACGGAGAGCTCTTCTTGAACAAAGG[G/A]TAGGAGAGAGAGAAAAGGAATTGGACTGAATGTTGCTCGTTAAATAKGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19987
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114631 Nonsense 1008 1141 19 19
Genomic Location (Zv9):
Chromosome 3 (position 21355933)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 21012324
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CATCTTCCTCGCATCATCACCTCCGCTACATCCCGCAGCAGTACCACCAT[C/T]AGAGCACCCCACACCTGTACCGCGACAGCCGAGAGAGAGAGTGGGGAAGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link