hes2.1

Ensembl ID:
ENSDARG00000074897
ZFIN ID:
ZDB-GENE-081104-104
Description:
hypothetical protein LOC559147 [Source:RefSeq peptide;Acc:NP_001116717]
Human Orthologue:
HES2
Human Description:
hairy and enhancer of split 2 (Drosophila) [Source:HGNC Symbol;Acc:16005]
Mouse Orthologue:
Hes2
Mouse Description:
hairy and enhancer of split 2 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:1098624]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa34488 Essential Splice Site Mutation detected in F1 DNA During 2017
sa7157 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa34488
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111075 Essential Splice Site 63 195 2 5
ENSDART00000143321 Essential Splice Site 63 150 2 5
Genomic Location (Zv9):
Chromosome 8 (position 49082038)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 46935433
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGCCTCAATCACCTAAAAACTCTTATTCTCCCACTGGTCGGCAAAGATG[T/G]AAGTATCTTAACTTTGTTTCTTTGGCAATACATACAATACTAATAAATCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7157
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111075 Nonsense 98 195 4 5
ENSDART00000143321 Nonsense 98 150 4 5
Genomic Location (Zv9):
Chromosome 8 (position 49081717)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 46935112
KASP Assay ID:
554-4545.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACTTTATTAATTKTCTCCCTTTTTCTCCTTAAAGGTCAAACAGACAGCTA[T/G]AAAGAGGGCTATAAAGCCTGCTTGCAGCGCATATCTACGATGCTCCCGCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link