tysnd1

Ensembl ID:
ENSDARG00000074895
ZFIN ID:
ZDB-GENE-030131-8525
Description:
peroxisomal leader peptide-processing protease [Source:RefSeq peptide;Acc:NP_001122182]
Human Orthologue:
TYSND1
Human Description:
trypsin domain containing 1 [Source:HGNC Symbol;Acc:28531]
Mouse Orthologue:
Tysnd1
Mouse Description:
trypsin domain containing 1 Gene [Source:MGI Symbol;Acc:MGI:1919017]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa5862 Essential Splice Site Mutation detected in F1 DNA During 2014
sa12043 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa5862
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110157 Essential Splice Site 393 521 3 4
ENSDART00000124122 Essential Splice Site 393 565 3 5
ENSDART00000146097 Essential Splice Site 393 521 4 5
Genomic Location:
Chromosome 13 (position 30362488)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGTGTTTTTATCCCTGTGMAGCGGCTGACATATTGCTGTTGKGTTTGCTT[A/C]GGTGAGGATGTGGTYGTTGTGGGTTATGGAGCTTTAGGGAGCCGCTGCGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12043
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110157 Nonsense 470 521 4 4
ENSDART00000124122 Nonsense 470 565 4 5
ENSDART00000146097 Nonsense 470 521 5 5
Genomic Location:
Chromosome 13 (position 30359784)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTAGGTATTGTGTCCAGCAACACTCGAGACTATGCAGCAAAAGTGACGTA[T/A]CCACACCTGAACTTCAGCATCCCGGTGACTCTTCTGGAGCCTCTGCTCAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/j3fcgq00