pde6d

Ensembl ID:
ENSDARG00000074892
ZFIN ID:
ZDB-GENE-040718-463
Description:
retinal rod rhodopsin-sensitive cGMP 3',5'-cyclic phosphodiesterase subunit delta [Source:RefSeq pe
Human Orthologue:
PDE6D
Human Description:
phosphodiesterase 6D, cGMP-specific, rod, delta [Source:HGNC Symbol;Acc:8788]
Mouse Orthologue:
Pde6d
Mouse Description:
phosphodiesterase 6D, cGMP-specific, rod, delta Gene [Source:MGI Symbol;Acc:MGI:1270843]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa33882 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa33882
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114172 Essential Splice Site 124 150 5 5
Genomic Location (Zv9):
Chromosome 6 (position 29419271)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 29714914
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATATAATTTAATCAAAGTTGATCTGTAATAATCATGGCTTTTCTCTTGCA[G/A]TGGTAATGTTGTTATAGAGACCAAGTTTTTTGATGACGACCTTCATGTCA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Height: Many sequence variants affecting diversity of adult human height. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link