abcd1

Ensembl ID:
ENSDARG00000074876
ZFIN ID:
ZDB-GENE-050517-27
Description:
ATP-binding cassette sub-family D member 1 [Source:RefSeq peptide;Acc:NP_001104656]
Human Orthologue:
ABCD1
Human Description:
ATP-binding cassette, sub-family D (ALD), member 1 [Source:HGNC Symbol;Acc:61]
Mouse Orthologue:
Abcd1
Mouse Description:
ATP-binding cassette, sub-family D (ALD), member 1 Gene [Source:MGI Symbol;Acc:MGI:1349215]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa21198 Essential Splice Site Mutation detected in F1 DNA During 2014
sa509 Splice Site, Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa21198
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111392 Essential Splice Site 367 766 2 10
Genomic Location:
Chromosome 8 (position 8598482)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGTTATGGTTGCTGTGCCTATCATCACTGCCACCGGATACTCTAAATATG[G/A]TATGGATTCAATTATGATTACGATCTGTAGTTCCTGTTCTCATCTTTCTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa509
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111392 Splice Site, Nonsense 672 766 9 10
Genomic Location:
Chromosome 8 (position 8626015)
KASP Assay ID:
554-0228.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAAGGATGCCGGGATTTCGCTCCTCTCCATTACTCACCGTCCTTCTCTCT[G/A]GTGGGTTTTGAATCGTATGAAAATGAACAGCAGTTCGTTTATTACCAGAA
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/4yo8pe6n