abcd1

Ensembl ID:
ENSDARG00000074876
ZFIN ID:
ZDB-GENE-050517-27
Description:
ATP-binding cassette sub-family D member 1 [Source:RefSeq peptide;Acc:NP_001104656]
Human Orthologue:
ABCD1
Human Description:
ATP-binding cassette, sub-family D (ALD), member 1 [Source:HGNC Symbol;Acc:61]
Mouse Orthologue:
Abcd1
Mouse Description:
ATP-binding cassette, sub-family D (ALD), member 1 Gene [Source:MGI Symbol;Acc:MGI:1349215]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa41121 Nonsense Mutation detected in F1 DNA During 2016
sa34298 Nonsense Mutation detected in F1 DNA During 2016
sa21198 Essential Splice Site Mutation detected in F1 DNA During 2016
sa509 Splice Site, Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa41121
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111392 Nonsense 46 766 1 10
Genomic Location (Zv9):
Chromosome 8 (position 8591072)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 8007654
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGAAGAAACTATCCCCGTACTTCTTCGGCAAGCTCAAAGGAAGGACTAGT[A/T]AACAAGTTAAGGGCGCTGACCCGCTTACCTCCAATGGAGAGCCCCTAGTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34298
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111392 Nonsense 311 766 2 10
Genomic Location (Zv9):
Chromosome 8 (position 8598311)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 8014893
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCGCGTGTGTTTGCGCGCCTGCGTGTGTGCCCTGCGCAGATCGAGATGT[T/A]GCAGCTGCAGCGGAGCTACAACTCGCTGTCCAGGCAGATTAACCTGATCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21198
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111392 Essential Splice Site 367 766 2 10
Genomic Location (Zv9):
Chromosome 8 (position 8598482)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 8015064
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGTTATGGTTGCTGTGCCTATCATCACTGCCACCGGATACTCTAAATATG[G/A]TATGGATTCAATTATGATTACGATCTGTAGTTCCTGTTCTCATCTTTCTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa509
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111392 Splice Site, Nonsense 672 766 9 10
Genomic Location (Zv9):
Chromosome 8 (position 8626015)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 8042597
KASP Assay ID:
554-0228.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAAGGATGCCGGGATTTCGCTCCTCTCCATTACTCACCGTCCTTCTCTCT[G/A]GTGGGTTTTGAATCGTATGAAAATGAACAGCAGTTCGTTTATTACCAGAA
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link