si:ch1073-291c23.2

Ensembl ID:
ENSDARG00000074869
ZFIN ID:
ZDB-GENE-081107-2
Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:B8JMF6]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa2707 Essential Splice Site F2 line generated During 2017
sa42104 Essential Splice Site Mutation detected in F1 DNA During 2017
sa44779 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa2707
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102941   None 196 None 6
ENSDART00000109634 Essential Splice Site 84 204 4 7
ENSDART00000133731   None 61 None 2
ENSDART00000140326   None 85 None 3
ENSDART00000142695   None 69 None 3
ENSDART00000147058   None 110 None 3

The following transcripts of ENSDARG00000074869 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 13 (position 235104)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 215123
KASP Assay ID:
554-3209.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGACTGANNNNNNNNTGATGTTGAATCACTAAGCATCTTGTCTTCTGTGC[A/T]GTTCTGTGTCTRTGGCRTTTTGTACATACTGTCTGAACGCAGCCCCWCCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42104
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102941   None 196 None 6
ENSDART00000109634 Essential Splice Site 102 204 4 7
ENSDART00000133731   None 61 None 2
ENSDART00000140326   None 85 None 3
ENSDART00000142695   None 69 None 3
ENSDART00000147058   None 110 None 3

The following transcripts of ENSDARG00000074869 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 13 (position 235044)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 215063
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGTGGCGTTTTGTACATACTGTCTGAACGCAGCCCCTCCAAAAAGATCG[T/C]AAGTGTTTTATCCATCATCCAGATATTCAGTAAACGTTTTCTGCAATCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44779
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102941   None 196 None 6
ENSDART00000109634 Nonsense 149 204 5 7
ENSDART00000133731   None 61 None 2
ENSDART00000140326   None 85 None 3
ENSDART00000142695   None 69 None 3
ENSDART00000147058   None 110 None 3

The following transcripts of ENSDARG00000074869 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 13 (position 234777)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGTCAAGATGAGTACACCCATAACAACATCACAGAGGATGACTACGTTTA[T/A]CTGAGACAACACTATGTGAGGGGTTTTATTCACTTATTCATTTGTGTTGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link