si:ch1073-291c23.2

Ensembl ID:
ENSDARG00000074869
ZFIN ID:
ZDB-GENE-081107-2
Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:B8JMF6]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa2707 Essential Splice Site F2 line generated During 2017
sa42104 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa2707
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102941   None 196 None 6
ENSDART00000109634 Essential Splice Site 84 204 4 7
ENSDART00000133731   None 61 None 2
ENSDART00000140326   None 85 None 3
ENSDART00000142695   None 69 None 3
ENSDART00000147058   None 110 None 3

The following transcripts of ENSDARG00000074869 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 13 (position 235104)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 215123
KASP Assay ID:
554-3209.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGACTGANNNNNNNNTGATGTTGAATCACTAAGCATCTTGTCTTCTGTGC[A/T]GTTCTGTGTCTRTGGCRTTTTGTACATACTGTCTGAACGCAGCCCCWCCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42104
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102941   None 196 None 6
ENSDART00000109634 Essential Splice Site 102 204 4 7
ENSDART00000133731   None 61 None 2
ENSDART00000140326   None 85 None 3
ENSDART00000142695   None 69 None 3
ENSDART00000147058   None 110 None 3

The following transcripts of ENSDARG00000074869 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 13 (position 235044)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 215063
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGTGGCGTTTTGTACATACTGTCTGAACGCAGCCCCTCCAAAAAGATCG[T/C]AAGTGTTTTATCCATCATCCAGATATTCAGTAAACGTTTTCTGCAATCAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link