LOC100334881

Ensembl ID:
ENSDARG00000074867
Human Orthologue:
STIM2
Human Description:
stromal interaction molecule 2 [Source:HGNC Symbol;Acc:19205]
Mouse Orthologue:
Stim2
Mouse Description:
stromal interaction molecule 2 Gene [Source:MGI Symbol;Acc:MGI:2151156]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa9996 Nonsense Available for shipment Available now
sa32627 Nonsense Mutation detected in F1 DNA During 2016
sa39573 Essential Splice Site Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa9996
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114097 Nonsense 348 992 8 12
Genomic Location:
Chromosome 1 (position 13361081)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCCTTTGGTCAGTTCCTGAATCCTTGCAGCTKTGGCTACAGCTCACCCAT[G/T]AGGTGGAGGTTCAGTACTACAACGTCAAGAAGCAAAGTGCAGAACAACAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32627
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114097 Nonsense 524 992 11 12
Genomic Location:
Chromosome 1 (position 13364526)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCCATCTCCTGTCATTGTATCACCTGACCCAGACCTCCTGATACCCATA[C/T]GATCTCCACAAAGCCGATATGGAGATGATGAAGAAGGACATATCAAATAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39573
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114097 Essential Splice Site 546 992 11 12
Genomic Location:
Chromosome 1 (position 13364595)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGGAGATGATGAAGAAGGACATATCAAATACACCCCTATTGTGAAACAG[T/C]ACGTCTGCCTGGAATATATCCATTAGCTTTGCATTGATGAAATAAGGATT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link