ptpn5

Ensembl ID:
ENSDARG00000074866
ZFIN ID:
ZDB-GENE-101028-3
Description:
Protein-tyrosine phosphatase striatum-enriched [Source:UniProtKB/TrEMBL;Acc:C7U115]
Human Orthologue:
PTPN5
Human Description:
protein tyrosine phosphatase, non-receptor type 5 (striatum-enriched) [Source:HGNC Symbol;Acc:9657]
Mouse Orthologue:
Ptpn5
Mouse Description:
protein tyrosine phosphatase, non-receptor type 5 Gene [Source:MGI Symbol;Acc:MGI:97807]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa21036 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa21036
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114774 Nonsense 281 529 6 12
Genomic Location (Zv9):
Chromosome 7 (position 41035536)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 39371793
KASP Assay ID:
2259-9263.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCTGGTGGAAACAGGAGACTCCCATGAACTTTGTGGACCCAAAAGAATA[T/A]AGTATTCCTGGGGTGGTGAGGAAGAATCGCTACAAAACCATACTACCAAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link