FRMPD3

Ensembl ID:
ENSDARG00000074865
Description:
FERM and PDZ domain containing 3 [Source:HGNC Symbol;Acc:29382]
Human Orthologue:
FRMPD3
Human Description:
FERM and PDZ domain containing 3 [Source:HGNC Symbol;Acc:29382]
Mouse Orthologue:
Frmpd3
Mouse Description:
FERM and PDZ domain containing 3 Gene [Source:MGI Symbol;Acc:MGI:3646547]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa42359 Nonsense Mutation detected in F1 DNA During 2016
sa7385 Missense Mutation detected in F1 DNA During 2016
sa35648 Nonsense Mutation detected in F1 DNA During 2016
sa22433 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa42359
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110004 Nonsense 10 1661 1 17
Genomic Location (Zv9):
Chromosome 14 (position 12170694)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 11606467
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TACAACCTCAATTTATACTTTGTGTTACCCACCAAATAAATATTATGTCT[T/A]ATTTCTTAGCTCTGTGATGTTAGAAGATGGTCAAGATGGAATGGACAGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7385
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110004 Missense 575 1661 14 17
Genomic Location (Zv9):
Chromosome 14 (position 12217094)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 11652867
KASP Assay ID:
554-4121.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGAGTTTCAGATACAAGCTGAACAGGAACTTGACRTTAACGAGAACCTCA[T/A]TTCGCAGGTGCAGAGTCGCTCACGAACAAAGTCTGACCCCACTTTAAAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35648
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110004 Nonsense 826 1661 15 17
Genomic Location (Zv9):
Chromosome 14 (position 12218240)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 11654013
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GATGTGTCGGAGATGGTGTCTGCAATGAAGCAACATCAGAACCAGGCCTA[T/A]TTACTAGCCCACCACATCAACAAAGAGCGACTTTTCAGTCGACGAGATTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22433
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110004 Nonsense 1346 1661 17 17
Genomic Location (Zv9):
Chromosome 14 (position 12219822)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 11655595
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCCCATGTGCACCACCCGTACAGAATCCATAGGTGCACCACATTACAAA[A/T]AGCTACAAAGGAGATATAGTATAGGGGAAATCGAAAATAATGGCAGCACC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link