si:dkey-200l5.5

Ensembl ID:
ENSDARG00000074858
ZFIN ID:
ZDB-GENE-030131-2310
Human Orthologue:
STARD7
Human Description:
StAR-related lipid transfer (START) domain containing 7 [Source:HGNC Symbol;Acc:18063]
Mouse Orthologue:
Stard7
Mouse Description:
START domain containing 7 Gene [Source:MGI Symbol;Acc:MGI:2139090]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa9576 Nonsense Available for shipment Available now
sa12622 Nonsense Available for shipment Available now
sa41630 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa9576
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112560 Nonsense 282 403 5 8
ENSDART00000147553 Nonsense 244 364 5 8
ENSDART00000112560 Nonsense 282 403 5 8
ENSDART00000147553 Nonsense 244 364 5 8
Genomic Location (Zv9):
Chromosome 10 (position 17735344)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 17747690
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTCTATGTGCGTCGATATCAAGTCGACCTAGAGAACAACTTGATGATCT[T/G]AGTCTCAAGGTAAGTGCTGTTGCMAGTTTGTTGTTCACTATTTGTTTATW
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12622
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112560 Nonsense 282 403 5 8
ENSDART00000147553 Nonsense 244 364 5 8
ENSDART00000112560 Nonsense 282 403 5 8
ENSDART00000147553 Nonsense 244 364 5 8
Genomic Location (Zv9):
Chromosome 10 (position 17735344)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 17747690
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTCTATGTGCGTCGATATCAAGTCGACCTAGAGAACAACTTGATGATCT[T/C]AGTCTCAAGGTAAGTGCTGTTGCMAGTTTGTTGTTCACTATTTGTTTATW
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41630
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112560 Nonsense 387 403 8 8
ENSDART00000147553 Nonsense 348 364 8 8
Genomic Location (Zv9):
Chromosome 10 (position 17732600)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 17744946
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCACGACTATGTCAATGTTGTAAAACCTTCTCAACCCTCCCAAGAACAA[C/T]GACTAGGAGCTGAAAACACTCACACTGCAGGCTCAAGTCAGATCTACGCC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Cardiac Troponin-T levels: Association of genome-wide variation with highly sensitive cardiac troponin-T levels in European Americans and Blacks: a meta-analysis from atherosclerosis risk in communities and cardiovascular health studies. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link