ENSDARG00000074856

Ensembl ID:
ENSDARG00000074856
Human Orthologue:
FCGBP
Human Description:
Fc fragment of IgG binding protein [Source:HGNC Symbol;Acc:13572]
Mouse Orthologues:
9530053A07Rik, Fcgbp
Mouse Descriptions:
Fc fragment of IgG binding protein Gene [Source:MGI Symbol;Acc:MGI:2444336]
RIKEN cDNA 9530053A07 gene Gene [Source:MGI Symbol;Acc:MGI:2442118]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa38209 Nonsense Mutation detected in F1 DNA During 2016
sa44421 Nonsense Mutation detected in F1 DNA During 2016
sa24776 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa38209
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111258 Nonsense 631 1003 6 7
Genomic Location (Zv9):
Chromosome Zv9_NA719 (position 16996)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 36526417
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTAGGTGGATGGCCAATTAGCAGATCTTCCGTTTTTGCTGAAAGGCATGT[T/A]AATAGTTTTCCGTAGCGGTAACACTGCTGTGTTGAAGACAAACTTTGGTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44421
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111258 Nonsense 747 1003 6 7
Genomic Location (Zv9):
Chromosome Zv9_NA719 (position 17343)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 36526070
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAAATGCAGAGTGCTATTGTGAGATCATTGCAAATCGGACAGGGCCTTTC[A/T]GAGAATGTCACACCTATATTGATCCTGGGCCTTATGTAGAGGACTGCATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24776
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111258 Nonsense 826 1003 7 7
Genomic Location (Zv9):
Chromosome Zv9_NA719 (position 18627)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 36524786
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AACAGCCACTACAACTCCTGTTCCCCAGGCTGCACAGAGACCTGCGCCTA[T/A]CTATCTGAACACAACTGTACCAGACCCTGTGCTGAGGCCTGCCAGTGTGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link