ENSDARG00000074856

Ensembl ID:
ENSDARG00000074856
Human Orthologue:
FCGBP
Human Description:
Fc fragment of IgG binding protein [Source:HGNC Symbol;Acc:13572]
Mouse Orthologues:
9530053A07Rik, Fcgbp
Mouse Descriptions:
Fc fragment of IgG binding protein Gene [Source:MGI Symbol;Acc:MGI:2444336]
RIKEN cDNA 9530053A07 gene Gene [Source:MGI Symbol;Acc:MGI:2442118]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa24776 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa24776
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111258 Nonsense 826 1003 7 7
Genomic Location:
Chromosome Zv9_NA719 (position 18627)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AACAGCCACTACAACTCCTGTTCCCCAGGCTGCACAGAGACCTGCGCCTA[T/A]CTATCTGAACACAACTGTACCAGACCCTGTGCTGAGGCCTGCCAGTGTGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/91jes2zw