si:ch73-119d10.1

Ensembl ID:
ENSDARG00000074854
ZFIN ID:
ZDB-GENE-091204-326
Human Orthologue:
SH2D1A
Human Description:
SH2 domain containing 1A [Source:HGNC Symbol;Acc:10820]
Mouse Orthologue:
Sh2d1a
Mouse Description:
SH2 domain protein 1A Gene [Source:MGI Symbol;Acc:MGI:1328352]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa30673 Nonsense Mutation detected in F1 DNA During 2017
sa14067 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa30673
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108641 Nonsense 7 108 1 3
ENSDART00000135662 Nonsense 7 102 1 3
Genomic Location (Zv9):
Chromosome 14 (position 9218361)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 8822843
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GATTGTCTGAAATACAATGCTTGCAGCACAATGGAATCGCTTTCTGTTTA[T/G]CACGGTGCCATCAGCCGAGAAATGTGTGAGATGCGCCTGAATGAAGCGGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14067
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108641 Nonsense 79 108 3 3
ENSDART00000135662 Nonsense 79 102 3 3
Genomic Location (Zv9):
Chromosome 14 (position 9207248)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 8811730
KASP Assay ID:
2260-7284.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CATTATTATTTTGACAGACAGCTCCAGGACAGACTAAACGCTTGTTCCGC[A/T]RAGTCAAGAATTTGATAAGTGCTTTTGAGAAACCAGGCCAGGGCATCGCC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link