CNNM3

Ensembl ID:
ENSDARG00000074853
Description:
cyclin M3 [Source:HGNC Symbol;Acc:104]
Human Orthologue:
CNNM3
Human Description:
cyclin M3 [Source:HGNC Symbol;Acc:104]
Mouse Orthologue:
Cnnm3
Mouse Description:
cyclin M3 Gene [Source:MGI Symbol;Acc:MGI:2151055]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa4418 Essential Splice Site F2 line generated During 2014

Mutation Details

Allele Name:
sa4418
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111766 Essential Splice Site 641 731 5 7
Genomic Location:
Chromosome 11 (position 21279632)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGCGCCTTCACGTATTAYGGTGTTTCAGCGCTCACCGCTCCATCCTCAGG[T/G]CAGACAGTCAATARTAATCAGCAGTTCTCTTCAWTATCAGTGCTCTATAT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/w88b0h9j