il12rb2l

Ensembl ID:
ENSDARG00000074850
ZFIN IDs:
ZDB-GENE-080107-6, ZDB-GENE-091204-58
Description:
Interleukin 12 receptor beta 2.b [Source:UniProtKB/TrEMBL;Acc:A8WHA9]
Human Orthologue:
IL12RB2
Human Description:
interleukin 12 receptor, beta 2 [Source:HGNC Symbol;Acc:5972]
Mouse Orthologue:
Il12rb2
Mouse Description:
interleukin 12 receptor, beta 2 Gene [Source:MGI Symbol;Acc:MGI:1270861]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa33137 Nonsense Mutation detected in F1 DNA During 2017
sa30603 Essential Splice Site, Missense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa33137
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110287 Nonsense 308 761 7 15
ENSDART00000134433 Nonsense 308 674 7 14
Genomic Location (Zv9):
Chromosome 3 (position 19050034)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 19078396
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAACTGACAAAGACTTTTTCTTTTCTCATATGTTTTCAATAGCTCCAGTT[G/T]GACAGCTGGATGTTTGGAGTGACTGCGCACCTAATTCTGACAAATCATCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30603
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Essential Splice Site, Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110287 Essential Splice Site 628 761 14 15
ENSDART00000134433 Missense 641 674 14 14
Genomic Location (Zv9):
Chromosome 3 (position 19060189)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 19088551
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTATTAAATTAGACACATCATGGTAAATTTATTTCTGCTGTTTACCCGCA[G/T]GTTATCTTACTGTCACTGTTTTGAGAAGATTCCAGATCCAATAAACAGCA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link