si:dkey-11p10.8

Ensembl ID:
ENSDARG00000074843
ZFIN ID:
ZDB-GENE-030131-3235
Human Orthologue:
PHLDB2
Human Description:
pleckstrin homology-like domain, family B, member 2 [Source:HGNC Symbol;Acc:29573]
Mouse Orthologue:
Phldb2
Mouse Description:
pleckstrin homology-like domain, family B, member 2 Gene [Source:MGI Symbol;Acc:MGI:2444981]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa37899 Nonsense Available for shipment Available now
sa24511 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa37899
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111552 Nonsense 746 1361 9 22
ENSDART00000141601 Nonsense 591 1163 6 18
Genomic Location (Zv9):
Chromosome 24 (position 25728398)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 24975276
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGCAGGATTCGGAGATGGCTCAGCTGCAGCAGGAAAAAGACACTCTGGAG[C/T]AGCTTAAAGAAAAGATGGCCGAAATCGAAAACAAAGCACAGACAGACAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24511
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111552 Essential Splice Site 1032 1361 15 22
ENSDART00000141601 Essential Splice Site 834 1163 11 18
Genomic Location (Zv9):
Chromosome 24 (position 25715473)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 24962351
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTACCCCACAATTCACCTGTGCCACCCTGGGTCGCAACATATCCCCTAAA[G/A]TAAGAACACACTATTCATTCATTTATTTTCTTTTCGGCTTAGTCCCTTTA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link