NP_001155915.1

Ensembl ID:
ENSDARG00000074842
Description:
sorting nexin-8 [Source:RefSeq peptide;Acc:NP_001155915]
Human Orthologue:
SNX8
Human Description:
sorting nexin 8 [Source:HGNC Symbol;Acc:14972]
Mouse Orthologue:
Snx8
Mouse Description:
sorting nexin 8 Gene [Source:MGI Symbol;Acc:MGI:2443816]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa33282 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa33282
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109392 Nonsense 307 480 8 13
Genomic Location (Zv9):
Chromosome 3 (position 42101706)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 41965066
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATATCCATAGCAGTTTTCAGAAGTTACGGGACAGGGCAGAGAAAATGGCC[G/T]AGCGTTCGAAGGACAATGCCACAGATCTGCTGATGTTTGGGAAAGAGCTG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Schizophrenia: Genome-wide association study in a Swedish population yields support for greater CNV and MHC involvement in schizophrenia compared with bipolar disorder. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link