IMPG1 (2 of 2)

Ensembl ID:
ENSDARG00000074839
Description:
interphotoreceptor matrix proteoglycan 1 [Source:HGNC Symbol;Acc:6055]
Human Orthologue:
IMPG1
Human Description:
interphotoreceptor matrix proteoglycan 1 [Source:HGNC Symbol;Acc:6055]
Mouse Orthologue:
Impg1
Mouse Description:
interphotoreceptor matrix proteoglycan 1 Gene [Source:MGI Symbol;Acc:MGI:1926876]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa36470 Nonsense Mutation detected in F1 DNA During 2017
sa28895 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa36470
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113892 Nonsense 3 827 1 14
Genomic Location (Zv9):
Chromosome 17 (position 36807103)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 36692000
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTTTCTGGAGACTCCGCAACAAAACAGACAGTTGACAGATGGCAGAGATT[C/A]ACTTTCTCTAGACCGCCATCGTGCAAAGAGATCAGCGCTGTTTGGGACGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa28895
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113892 Essential Splice Site 100 827 3 14
Genomic Location (Zv9):
Chromosome 17 (position 36816473)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 36701370
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTAAATGTTTTTGGCTTTATTGCACATTCTCAAACTTGTTTGTCATTTAC[A/T]GAGAGTGAACCAACTGGATGAACAGGATAGGTAAGAACCCGAAGATGATT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link