grap2b

Ensembl ID:
ENSDARG00000074837
ZFIN ID:
ZDB-GENE-040426-1485
Description:
GRB2-related adaptor protein 2b [Source:RefSeq peptide;Acc:NP_956972]
Human Orthologues:
GRAP2, NCK2
Human Descriptions:
GRB2-related adaptor protein 2 [Source:HGNC Symbol;Acc:4563]
NCK adaptor protein 2 [Source:HGNC Symbol;Acc:7665]
Mouse Orthologue:
Grap2
Mouse Description:
GRB2-related adaptor protein 2 Gene [Source:MGI Symbol;Acc:MGI:1333842]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa31495 Essential Splice Site Available for shipment Available now
sa14352 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa31495
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110189 Essential Splice Site 27 249 3 8
Genomic Location (Zv9):
Chromosome 6 (position 568294)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 410582
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTGACAACATCATGTATTTGGTCTGAGCTTAATTACCTTGTGCTCTTGT[A/T]GATTTTAGGCACCAATGACGACTGGTTCAGAGCTGAAATAAACGGTATGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14352
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110189 Nonsense 231 249 8 8
Genomic Location (Zv9):
Chromosome 6 (position 572721)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 406155
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGGCCGGAGACGTGATCGAGGTTYTGGATCAGTCCGATCGATCCTGGTGG[A/T]AAGGMGTCCTGCGTGGCAGAACTGGACTSTTCCCCGTCAACTACACCAAT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Addiction: NCK2 is significantly associated with opiates addiction in African-origin men. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link