grap2b

Ensembl ID:
ENSDARG00000074837
ZFIN ID:
ZDB-GENE-040426-1485
Description:
GRB2-related adaptor protein 2b [Source:RefSeq peptide;Acc:NP_956972]
Human Orthologues:
GRAP2, NCK2
Human Descriptions:
GRB2-related adaptor protein 2 [Source:HGNC Symbol;Acc:4563]
NCK adaptor protein 2 [Source:HGNC Symbol;Acc:7665]
Mouse Orthologue:
Grap2
Mouse Description:
GRB2-related adaptor protein 2 Gene [Source:MGI Symbol;Acc:MGI:1333842]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa31495 Essential Splice Site Mutation detected in F1 DNA During 2016
sa8216 Nonsense Mutation detected in F1 DNA During 2016
sa14352 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa31495
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110189 Essential Splice Site 27 249 3 8
Genomic Location:
Chromosome 6 (position 568294)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTGACAACATCATGTATTTGGTCTGAGCTTAATTACCTTGTGCTCTTGT[A/T]GATTTTAGGCACCAATGACGACTGGTTCAGAGCTGAAATAAACGGTATGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8216
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110189 Nonsense 83 249 4 8
Genomic Location:
Chromosome 6 (position 571438)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGTCTGCACAGGATGAGCTGATGTGTCAACCAATAGGAGCCTTCATCATC[A/T]GAGGATCCCAGAGCTCACCTGGGGAYTTYTCCATCTCAGTCAGGTACATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14352
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110189 Nonsense 231 249 8 8
Genomic Location:
Chromosome 6 (position 572721)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGGCCGGAGACGTGATCGAGGTTYTGGATCAGTCCGATCGATCCTGGTGG[A/T]AAGGMGTCCTGCGTGGCAGAACTGGACTSTTCCCCGTCAACTACACCAAT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Addiction: NCK2 is significantly associated with opiates addiction in African-origin men. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link