si:ch73-184c24.1

Ensembl ID:
ENSDARG00000074827
ZFIN ID:
ZDB-GENE-100922-80
Human Orthologue:
C1orf116
Human Description:
chromosome 1 open reading frame 116 [Source:HGNC Symbol;Acc:28667]
Mouse Orthologue:
AA986860
Mouse Description:
expressed sequence AA986860 Gene [Source:MGI Symbol;Acc:MGI:2138143]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa37784 Nonsense Mutation detected in F1 DNA During 2017
sa44047 Nonsense Mutation detected in F1 DNA During 2017
sa44046 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa37784
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109982 Nonsense 60 464 2 7
ENSDART00000146808 Nonsense 65 130 3 4
Genomic Location (Zv9):
Chromosome 23 (position 41901314)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 41735439
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCCTGCTTGATGTTTCTGGAGGAGACCATTGAGTCTTTGGAGGCAGAATA[T/A]GACAGCGGTTTGTCAAACGATGAGCCTGATTGTCCATCCAATGGCCTGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44047
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109982   None 464 None 7
ENSDART00000146808 Nonsense 95 130 3 4
Genomic Location (Zv9):
Chromosome 23 (position 41901226)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 41735351
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCAATGGCCTGAAAGAAAACATTGCTCATCCGACCTCCATCAGTCAGAAC[A/T]AATCTCAGGGTAAACACCAACACCAGAAACATCTACGGCAGTGGTTTTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44046
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109982 Essential Splice Site 99 464 None 7
ENSDART00000146808 Essential Splice Site 98 130 None 4
Genomic Location (Zv9):
Chromosome 23 (position 41900052)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 41734177
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGAGAGATAGCTTGGGATGTTTCAATAATAGCCTATAAATGTTCTCTTTC[A/T]GAGTTCTCTACCCTCGAAGGTCAAGTCAAAGTGATTGGAAAAGATGGTAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link