mxra5

Ensembl ID:
ENSDARG00000074815
ZFIN ID:
ZDB-GENE-090312-22
Human Orthologue:
MXRA5
Human Description:
matrix-remodelling associated 5 [Source:HGNC Symbol;Acc:7539]

Alleles

There are 9 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa12853 Nonsense Available for shipment Available now
sa39635 Nonsense Mutation detected in F1 DNA During 2016
sa10494 Essential Splice Site Available for shipment Available now
sa32705 Nonsense Mutation detected in F1 DNA During 2016
sa16998 Essential Splice Site Available for shipment Available now
sa39636 Nonsense Mutation detected in F1 DNA During 2016
sa14854 Nonsense Mutation detected in F1 DNA During 2016
sa16209 Nonsense Available for shipment Available now
sa31212 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa12853
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113486 Nonsense 340 2480 4 9
ENSDART00000137151   None 943 None 2
ENSDART00000140435   None 206 None 3
Genomic Location (Zv9):
Chromosome 1 (position 32990289)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 32592469
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAATGCCTTGTAATTGAGCMAAGAGAGCTTACYAGCATAGGCTGGGACTA[T/A]GTTMACCAGTACCAAATAWCAGTAAATTTGACTCTTACATTAGATTTGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39635
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113486 Nonsense 462 2480 4 9
ENSDART00000137151   None 943 None 2
ENSDART00000140435   None 206 None 3
Genomic Location (Zv9):
Chromosome 1 (position 32990653)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 32592833
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCTCAGCACCTATATGACTGATGTAATGGAAAGAGAAACCATAAGAAAG[C/T]AGAGTCAAGGCTGGGTCTTAATTGAGTCCAAGAATGACACCAGAACAATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10494
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113486 Essential Splice Site 761 2480 6 9
ENSDART00000137151   None 943 None 2
ENSDART00000140435   None 206 None 3
Genomic Location (Zv9):
Chromosome 1 (position 32991665)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 32593845
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGTTCGTAGTGGAGGAAATGATACAAAAGCAACTACTCCAARCTATGCTC[A/T]GACCAGTACAAACAAAATACAGGAGTCAGAGMAAAACACAAAGCAGTCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32705
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113486 Nonsense 1517 2480 6 9
ENSDART00000137151   None 943 None 2
ENSDART00000140435   None 206 None 3
Genomic Location (Zv9):
Chromosome 1 (position 32993937)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 32596117
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACCAGCACAAACATAAGATCAGTAACAGCACATGCCGAGACTAATGCCTA[T/A]TTACCATGTATGGCTGTGGGAAAACCCCATCCCTTCCTTACCTGGACTAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16998
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113486 Essential Splice Site 1845 2480 None 9
ENSDART00000137151 Essential Splice Site 308 943 None 2
ENSDART00000140435   None 206 None 3
Genomic Location (Zv9):
Chromosome 1 (position 32995032)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 32597212
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGATMATCTGGAGGACTCCATCTRAAAAGCTTGTGGATGCTCACTACAGG[T/A]AATATAAACACTTCACTGAAGCACATCTCCTTTGCAGGAAAGCACATTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39636
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113486 Nonsense 2099 2480 9 9
ENSDART00000137151 Nonsense 562 943 2 2
ENSDART00000140435   None 206 None 3
Genomic Location (Zv9):
Chromosome 1 (position 32996165)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 32598345
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGTGACCAGGGTAGAAATCCTTGTCTCTCCACCTGCAATTAATGGCTTC[A/T]AAGGCACCACAAACTCACTGAGAGTGTCTAGTGTTAGAGATCAGAGGAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14854
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113486 Nonsense 2128 2480 9 9
ENSDART00000137151 Nonsense 591 943 2 2
ENSDART00000140435   None 206 None 3
Genomic Location (Zv9):
Chromosome 1 (position 32996252)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 32598432
KASP Assay ID:
1641-0476.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAGATCAGAGGAAACTGATYGATTGTGACGCTACTGGTACCCCTGCYCCA[C/T]GAGTCATGTGGGTTCTTCCAGAGAATGTTGTACTTCCTGCACCATATTAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16209
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113486 Nonsense 2396 2480 9 9
ENSDART00000137151 Nonsense 859 943 2 2
ENSDART00000140435   None 206 None 3
Genomic Location (Zv9):
Chromosome 1 (position 32997058)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 32599238
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
RTTATTGCATWTCCACCACGTATCACTAGYGRTCCGGCTCCTGCTACCTA[T/A]GCCAAAAGAGGAGTWGCAGTTCAACTTAATTGCTTGGCCATAGGTATCCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31212
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113486 Nonsense 2414 2480 9 9
ENSDART00000137151 Nonsense 877 943 2 2
ENSDART00000140435   None 206 None 3
Genomic Location (Zv9):
Chromosome 1 (position 32997110)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 32599290
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCAAAAGAGGAGTTGCAGTTCAACTTAATTGCTTGGCCATAGGTATCCCC[A/T]AAGCAGAAGTAGCATGGGAGACCCCCGATCGAACACGGCTTATTGTCAGC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link