mxra5

Ensembl ID:
ENSDARG00000074815
ZFIN ID:
ZDB-GENE-090312-22
Human Orthologue:
MXRA5
Human Description:
matrix-remodelling associated 5 [Source:HGNC Symbol;Acc:7539]

Alleles

There are 6 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa12853 Nonsense Available for shipment Available now
sa10494 Essential Splice Site Available for shipment Available now
sa16998 Essential Splice Site Available for shipment Available now
sa14854 Nonsense Mutation detected in F1 DNA During 2014
sa16209 Nonsense Available for shipment Available now
sa4852 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa12853
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113486 Nonsense 340 2480 4 9
ENSDART00000137151 None None 943 None 2
ENSDART00000140435 None None 206 None 3
Genomic Location:
Chromosome 1 (position 32990289)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAATGCCTTGTAATTGAGCMAAGAGAGCTTACYAGCATAGGCTGGGACTA[T/A]GTTMACCAGTACCAAATAWCAGTAAATTTGACTCTTACATTAGATTTGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10494
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113486 Essential Splice Site 761 2480 6 9
ENSDART00000137151 None None 943 None 2
ENSDART00000140435 None None 206 None 3
Genomic Location:
Chromosome 1 (position 32991665)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGTTCGTAGTGGAGGAAATGATACAAAAGCAACTACTCCAARCTATGCTC[A/T]GACCAGTACAAACAAAATACAGGAGTCAGAGMAAAACACAAAGCAGTCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16998
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113486 Essential Splice Site 1845 2480 None 9
ENSDART00000137151 Essential Splice Site 308 943 None 2
ENSDART00000140435 None None 206 None 3
Genomic Location:
Chromosome 1 (position 32995032)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGATMATCTGGAGGACTCCATCTRAAAAGCTTGTGGATGCTCACTACAGG[T/A]AATATAAACACTTCACTGAAGCACATCTCCTTTGCAGGAAAGCACATTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14854
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113486 Nonsense 2128 2480 9 9
ENSDART00000137151 Nonsense 591 943 2 2
ENSDART00000140435 None None 206 None 3
Genomic Location:
Chromosome 1 (position 32996252)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAGATCAGAGGAAACTGATYGATTGTGACGCTACTGGTACCCCTGCYCCA[C/T]GAGTCATGTGGGTTCTTCCAGAGAATGTTGTACTTCCTGCACCATATTAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16209
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113486 Nonsense 2396 2480 9 9
ENSDART00000137151 Nonsense 859 943 2 2
ENSDART00000140435 None None 206 None 3
Genomic Location:
Chromosome 1 (position 32997058)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
RTTATTGCATWTCCACCACGTATCACTAGYGRTCCGGCTCCTGCTACCTA[T/A]GCCAAAAGAGGAGTWGCAGTTCAACTTAATTGCTTGGCCATAGGTATCCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa4852
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113486 Nonsense 2480 2480 9 9
ENSDART00000137151 Nonsense 943 943 2 2
ENSDART00000140435 None None 206 None 3
Genomic Location:
Chromosome 1 (position 32997310)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCCAGAAATGTAGTTGGGGTTGACACAAAGGGTACTTACCTTTATGTGTA[C/A]WGAAAAAATAYAACCATCTACAGGTCATATGCCCAAGGAACTRCGACGTT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/z41j316k