MEGF6 (2 of 2)

Ensembl ID:
ENSDARG00000074808
Description:
multiple EGF-like-domains 6 [Source:HGNC Symbol;Acc:3232]
Human Orthologue:
MEGF6
Human Description:
multiple EGF-like-domains 6 [Source:HGNC Symbol;Acc:3232]
Mouse Orthologue:
Megf6
Mouse Description:
multiple EGF-like-domains 6 Gene [Source:MGI Symbol;Acc:MGI:1919351]

Alleles

There are 11 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa3792 Nonsense Mutation detected in F1 DNA During 2014
sa24897 Essential Splice Site Mutation detected in F1 DNA During 2014
sa9346 Nonsense Mutation detected in F1 DNA During 2014
sa9355 Essential Splice Site Mutation detected in F1 DNA During 2014
sa19013 Essential Splice Site Mutation detected in F1 DNA During 2014
sa4437 Nonsense Mutation detected in F1 DNA During 2014
sa7679 Nonsense Mutation detected in F1 DNA During 2014
sa2600 Essential Splice Site Available for shipment Available now
sa15275 Essential Splice Site Available for shipment Available now
sa15985 Nonsense Available for shipment Available now
sa21975 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa3792
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109204 Nonsense 301 1318 10 35
Genomic Location:
Chromosome 11 (position 42858722)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTGGATGTGTTTATGCTGTGTGTTTTTGGTGCATYAGACATTGATGAGTG[T/A]GCGTYGGGTCAGACGGACTGTGCTCATGGCTGTCGTAACACCAGAGGATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24897
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109204 Essential Splice Site 427 1318 12 35
Genomic Location:
Chromosome 11 (position 42857052)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TACTGTACAGCCGGATATCGACTGAACACTGACGGATGCAGCTGTGATGG[T/C]AACACACATAAACTCACCAGGCCAGATTTTAAGAGAAGCTCATTACTTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9346
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109204 Nonsense 491 1318 15 35
Genomic Location:
Chromosome 11 (position 42850337)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AACAAACAAMCMTGYGTGTGTGTCAGTGATGGAGGAGTCAGTGGAGGCGT[T/A]GAGCAGCGGTCAGACAGTCAATAAACCTGGACCAGGACCTCAGCTCRCCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9355
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109204 Essential Splice Site 539 1318 15 35
ENSDART00000109204 Essential Splice Site 539 1318 15 35
Genomic Location:
Chromosome 11 (position 42850190)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGACGACACTGGAGAACTGCKYGCYGAGAGCACTTTAGCTGAGAAATTCR[G/T]TGAGAAACCCTTTCCTTCTGTTCTGTAACACTGCKGGGATTTMATKTAYT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19013
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109204 Essential Splice Site 539 1318 15 35
ENSDART00000109204 Essential Splice Site 539 1318 15 35
Genomic Location:
Chromosome 11 (position 42850190)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGACGACACTGGAGAACTGCGTGCCGAGAGCACTTTAGCTGAGAAATTCA[G/T]TGAGAAACCCTTTCCTTCTGTTCTGTAACACTGCTGGGATTTCATTTACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa4437
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109204 Nonsense 570 1318 16 35
Genomic Location:
Chromosome 11 (position 42849993)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTGAGGACTGTGTGAACGGAGGAGWGTGTAACAAACACAGAAATGCCTG[T/A]GACTGTCCTGACGGATGGACTGGAGTCGTCTGTAATGAGAGTGAGTTTGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7679
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109204 Nonsense 590 1318 17 35
Genomic Location:
Chromosome 11 (position 42849862)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTGAACCTGGACCACAACATCTTAACAGGATAGTTCACCYAAAAATRAA[C/T]AGTTCCTGTTAAAGGGCACCTATKGTGAAAAATCTACTTTTYAAGCTGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2600
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109204 Essential Splice Site 759 1318 21 35
Genomic Location:
Chromosome 11 (position 42843302)
KASP Assay ID:
554-2880.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTGTCAACCSAAATGTCCAGCTGGAAAAASAGGCGACAAATGTGACCAAG[G/C]TTTTTCAGAGTACTCATACACAACGTGTCTRTAGTTCATTATCTAAATTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15275
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109204 Essential Splice Site 760 1318 21 35
Genomic Location:
Chromosome 11 (position 42843301)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTCAAMCSAAATGTCCAGCTGGAAAAASAGGCGACAAATGTGACCAAGS[T/A]TTTTCAGAGTACTCATACACAACGTGTCTRTAGTTCATTATCTAAATTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15985
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109204 Nonsense 962 1318 26 35
Genomic Location:
Chromosome 11 (position 42832266)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGATGTGAATGTGTGAATGGAGCTCAGTGTGATRGTCAGACGGGTSGCTG[T/A]GTTTGTCCGCCGGGCTGGRCAGGAGAGCGCTGTGAGAATGGTGAGCTCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21975
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109204 Essential Splice Site 1019 1318 27 35
Genomic Location:
Chromosome 11 (position 42827191)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGTCAGTGTCTCTGCCCTGCTGGATGGAGAGGAAGACGCTGTGAGAAAGG[T/C]CAGCTCATTAAAAAAAATCAAATATATATAATAAATGACTTTATAAATAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/9pmscz2a