MEGF6 (2 of 2)

Ensembl ID:
ENSDARG00000074808
Description:
multiple EGF-like-domains 6 [Source:HGNC Symbol;Acc:3232]
Human Orthologue:
MEGF6
Human Description:
multiple EGF-like-domains 6 [Source:HGNC Symbol;Acc:3232]
Mouse Orthologue:
Megf6
Mouse Description:
multiple EGF-like-domains 6 Gene [Source:MGI Symbol;Acc:MGI:1919351]

Alleles

There are 12 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa41912 Essential Splice Site Mutation detected in F1 DNA During 2016
sa24897 Essential Splice Site Mutation detected in F1 DNA During 2016
sa9346 Nonsense Mutation detected in F1 DNA During 2016
sa9355 Essential Splice Site Mutation detected in F1 DNA During 2016
sa19013 Essential Splice Site Mutation detected in F1 DNA During 2016
sa41911 Nonsense Mutation detected in F1 DNA During 2016
sa2600 Essential Splice Site Available for shipment Available now
sa15275 Essential Splice Site Available for shipment Available now
sa41910 Essential Splice Site Mutation detected in F1 DNA During 2016
sa15985 Nonsense Available for shipment Available now
sa21975 Essential Splice Site Available for shipment Available now
sa35153 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa41912
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109204 Essential Splice Site 296 1318 9 35
Genomic Location (Zv9):
Chromosome 11 (position 42858860)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 41149355
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGAATGTCATCCAGGTTATCAGCTCGCTGAAGACGGCAAGACATGTGAAG[G/A]TAAAATACACCTGCCTGTCTTATATTTTAAGATCACAGAGAGTTCTCAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24897
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109204 Essential Splice Site 427 1318 12 35
Genomic Location (Zv9):
Chromosome 11 (position 42857052)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 41147547
KASP Assay ID:
554-7681.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TACTGTACAGCCGGATATCGACTGAACACTGACGGATGCAGCTGTGATGG[T/C]AACACACATAAACTCACCAGGCCAGATTTTAAGAGAAGCTCATTACTTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9346
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109204 Nonsense 491 1318 15 35
Genomic Location (Zv9):
Chromosome 11 (position 42850337)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 41140832
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AACAAACAAMCMTGYGTGTGTGTCAGTGATGGAGGAGTCAGTGGAGGCGT[T/A]GAGCAGCGGTCAGACAGTCAATAAACCTGGACCAGGACCTCAGCTCRCCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9355
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109204 Essential Splice Site 539 1318 15 35
ENSDART00000109204 Essential Splice Site 539 1318 15 35
Genomic Location (Zv9):
Chromosome 11 (position 42850190)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 41140685
KASP Assay ID:
2260-4670.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGACGACACTGGAGAACTGCKYGCYGAGAGCACTTTAGCTGAGAAATTCR[G/T]TGAGAAACCCTTTCCTTCTGTTCTGTAACACTGCKGGGATTTMATKTAYT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19013
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109204 Essential Splice Site 539 1318 15 35
ENSDART00000109204 Essential Splice Site 539 1318 15 35
Genomic Location (Zv9):
Chromosome 11 (position 42850190)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 41140685
KASP Assay ID:
2260-4670.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGACGACACTGGAGAACTGCGTGCCGAGAGCACTTTAGCTGAGAAATTCA[G/T]TGAGAAACCCTTTCCTTCTGTTCTGTAACACTGCTGGGATTTCATTTACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41911
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109204 Nonsense 725 1318 21 35
Genomic Location (Zv9):
Chromosome 11 (position 42843406)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 41133901
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TATTTTGTCCCCCTAATAGAGTGTGAATCAGGGTTTTTTGGCTCTGCTTG[T/A]GAGAATAAATGCTCTTGTCCGCCTGGAGTGACCTGTGATCATGTGACTGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2600
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109204 Essential Splice Site 759 1318 21 35
Genomic Location (Zv9):
Chromosome 11 (position 42843302)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 41133797
KASP Assay ID:
554-2880.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTGTCAACCSAAATGTCCAGCTGGAAAAASAGGCGACAAATGTGACCAAG[G/C]TTTTTCAGAGTACTCATACACAACGTGTCTRTAGTTCATTATCTAAATTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15275
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109204 Essential Splice Site 760 1318 21 35
Genomic Location (Zv9):
Chromosome 11 (position 42843301)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 41133796
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTCAAMCSAAATGTCCAGCTGGAAAAASAGGCGACAAATGTGACCAAGS[T/A]TTTTCAGAGTACTCATACACAACGTGTCTRTAGTTCATTATCTAAATTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41910
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109204 Essential Splice Site 804 1318 23 35
Genomic Location (Zv9):
Chromosome 11 (position 42838134)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 41128629
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCACGTCATGAATGTTACAGTATTTGTCATGTGTTTACGGAATCTGTCCC[A/T]GAATGCCCGGCTGGCTCGTTTGGGCCCGGCTGTAAGCATCGCTGCCAGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15985
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109204 Nonsense 962 1318 26 35
Genomic Location (Zv9):
Chromosome 11 (position 42832266)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 41122761
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGATGTGAATGTGTGAATGGAGCTCAGTGTGATRGTCAGACGGGTSGCTG[T/A]GTTTGTCCGCCGGGCTGGRCAGGAGAGCGCTGTGAGAATGGTGAGCTCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21975
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109204 Essential Splice Site 1019 1318 27 35
Genomic Location (Zv9):
Chromosome 11 (position 42827191)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 41117686
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGTCAGTGTCTCTGCCCTGCTGGATGGAGAGGAAGACGCTGTGAGAAAGG[T/C]CAGCTCATTAAAAAAAATCAAATATATATAATAAATGACTTTATAAATAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35153
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109204 Nonsense 1233 1318 33 35
Genomic Location (Zv9):
Chromosome 11 (position 42814861)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 41105356
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGGATACAGGACAGTGTGTGTGTCCCGCTGGAGTCCACGGCCCGCGCTGT[C/T]AGCACGGTCAGACCTACAGTATATACATCAGTCAACACACACTTGAATAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link