LOC567369

Ensembl ID:
ENSDARG00000074806
Human Orthologue:
AFAP1L2
Human Description:
actin filament associated protein 1-like 2 [Source:HGNC Symbol;Acc:25901]
Mouse Orthologue:
Afap1l2
Mouse Description:
actin filament associated protein 1-like 2 Gene [Source:MGI Symbol;Acc:MGI:2147658]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa35316 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa35316
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102081 Essential Splice Site 73 859 3 19
Genomic Location (Zv9):
Chromosome 12 (position 31848437)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 30157780
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CATGAACAAGGTCATTGTCACATGTCAAACCCAGGACAAAACAAACAGAG[G/A]TGAGCCTTAACCTTTACTTTCATTAACTTCTGCAGGTGTGAGGATGCAAA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link