LOC100001490

Ensembl ID:
ENSDARG00000074804
Human Orthologue:
ATXN7
Human Description:
ataxin 7 [Source:HGNC Symbol;Acc:10560]
Mouse Orthologue:
Atxn7
Mouse Description:
ataxin 7 Gene [Source:MGI Symbol;Acc:MGI:2179277]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa35068 Nonsense Mutation detected in F1 DNA During 2017
sa35067 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa35068
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110499 Nonsense 432 866 8 12
Genomic Location (Zv9):
Chromosome 11 (position 19944748)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 19362062
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCAACAGCAGTAACTCTCACAGTGGAGGAGACCCAGCCATGGCCCACGAC[C/T]AGGCCCACCACTCTCACCCAGCCCCTGTCGGTCCCGAGACAAGCCGCGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35067
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110499 Nonsense 832 866 11 12
Genomic Location (Zv9):
Chromosome 11 (position 19939968)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 19357282
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGGAACAGGAGTGGGAGGTGGACAAGGTCCTGGCAGGCCCAAAATGGCC[A/T]AATCTCCATCAATCAACAACATTCACAGCAAACACGCTCGCTCTATACCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link