si:dkey-11f4.7

Ensembl ID:
ENSDARG00000074800
ZFIN ID:
ZDB-GENE-070912-361
Human Orthologues:
AP005117.2, FAM38B
Human Descriptions:
family with sequence similarity 38, member B [Source:HGNC Symbol;Acc:26270]
Transmembrane protein C18orf30 [Source:UniProtKB/Swiss-Prot;Acc:Q8N787]
Mouse Orthologue:
Fam38b
Mouse Description:
family with sequence similarity 38, member B Gene [Source:MGI Symbol;Acc:MGI:1918781]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa41324 Nonsense Mutation detected in F1 DNA During 2017
sa6107 Nonsense Mutation detected in F1 DNA During 2017
sa18490 Essential Splice Site Available for shipment Available now
sa18491 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa41324
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109758   None 324 None 6
ENSDART00000111349 Nonsense 118 1532 3 37
ENSDART00000131483   None 287 None 5
ENSDART00000133933   None 156 None 3
ENSDART00000134867   None 147 None 3
ENSDART00000142679 Nonsense 181 306 4 5
ENSDART00000148338   None 177 None 3
Genomic Location (Zv9):
Chromosome 9 (position 96334)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 388176
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCATGTGTCCCCCGTCAGATGACTGTCTGCTGCTGCTGGTGGCGTCGCTG[C/T]AGTGGAAGGTGTTCGAGGAGGAAAATCAGGCCTGTGTGAGACTCCTCGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6107
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109758   None 324 None 6
ENSDART00000111349 Nonsense 199 1532 4 37
ENSDART00000131483   None 287 None 5
ENSDART00000133933   None 156 None 3
ENSDART00000134867   None 147 None 3
ENSDART00000142679 Nonsense 262 306 5 5
ENSDART00000148338   None 177 None 3
Genomic Location (Zv9):
Chromosome 9 (position 96694)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 387816
KASP Assay ID:
554-3755.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTCATCTTCATCACGGGAACCACCAGGATTAACATGCTGTGTCTGGGTTA[T/A]CTGGTGGCCTGCTTCTACTTCATGCTGTTCGGAGGCACATTACTGCTGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18490
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109758   None 324 None 6
ENSDART00000111349 Essential Splice Site 1166 1532 30 37
ENSDART00000131483 Essential Splice Site 224 287 4 5
ENSDART00000133933   None 156 None 3
ENSDART00000134867   None 147 None 3
ENSDART00000142679   None 306 None 5
ENSDART00000148338   None 177 None 3
Genomic Location (Zv9):
Chromosome 9 (position 117674)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 366836
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACATYTACGCCAACATCTTCATCCTCAAGTGCTGGAGAGAAGCAGAAAAG[G/A]TSCAACTTGACTGTMGGGSTGTGAACAWACACTCAGGATRTCTTAAAATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18491
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109758   None 324 None 6
ENSDART00000111349 Nonsense 1412 1532 36 37
ENSDART00000131483   None 287 None 5
ENSDART00000133933   None 156 None 3
ENSDART00000134867   None 147 None 3
ENSDART00000142679   None 306 None 5
ENSDART00000148338 Nonsense 56 177 2 3
Genomic Location (Zv9):
Chromosome 9 (position 123308)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 361202
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAGTCTCCAGCAGGGGAACCGCAGCTCCCCAGACAGCGCYCCGCAGTGGT[G/A]GGTGGTGCAGGAGTGCWGGCCCGGACCTCCACCCAGCAGCTGCCGCAGTA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link